Loading...
University of Agricultural Sciences, Bengaluru
University of Agricultural Sciences Bangalore, a premier institution of agricultural education and research in the country, began as a small agricultural research farm in 1899 on 30 acres of land donated by Her Excellency Maharani Kempa Nanjammanni Vani Vilasa Sannidhiyavaru, the Regent of Mysore and appointed Dr. Lehmann, German Scientist to initiate research on soil crop response with a Laboratory in the Directorate of Agriculture. Later under the initiative of the Dewan of Mysore Sir M. Vishweshwaraiah, the Mysore Agriculture Residential School was established in 1913 at Hebbal which offered Licentiate in Agriculture and later offered a diploma programme in agriculture during 1920. The School was upgraded to Agriculture Collegein 1946 which offered four year degree programs in Agriculture. The Government of Mysore headed by Sri. S. Nijalingappa, the then Chief Minister, established the University of Agricultural Sciences on the pattern of Land Grant College system of USA and the University of Agricultural Sciences Act No. 22 was passed in Legislative Assembly in 1963. Dr. Zakir Hussain, the Vice President of India inaugurated the University on 21st August 1964.
Browse
11 results
Search Results
ThesisItem Open Access MORPHO-METRIC TRAITS AND SSR MARKER ASSAY-BASED DIVERSITY AMONG HOT PEPPER (Capsicum annuum L.) WORKING COLLECTION(UNIVERSITY OF AGRICULTURAL SCIENCES GKVK, BENGALURU, 2016-08-17) ASHWINI JAIN, J; MOHAN RAO, AIncrease use of genetic resources (GR) is a pre-requisite for developing crop cultivars with broad genetic base which contribute to sustainable production. Precise information on diversity of GR at phenotypic and genotypic levels help enhance their enhanced use. Thirty two hot pepper working collection’ genotypes were phenotyped for morpho-metric traits following field trial at the experimental plot of the department of Genetics and Plant Breeding (GPB), University of Agricultural Sciences (UAS), Bengaluru during 2013. They were also assayed using SSR markers at the Hot Pepper improvement unit, Department of GPB, UAS, Bengaluru. Appreciable magnitudes of variation was observed for single fruit weight, green fruit yield plant-1, red fruit yield plant-1, capsaicin and oleoresin contents. The working collection’ genotypes were grouped into five clusters based on K-means clustering approach. Twenty nine of 50 SSR markers were polymorphic among the 31 genotypes. The number of alleles per SSR locus varied from 1 to 4 with an average of 1.8 alleles. Polymorphic Information Content ranged from 0.00 to 0.64 with an average of 0.21. Four pairs of genotypes; Lampang Local Short and Wakako Long, Lampang Local Short and CMS 6B, CMS 7B and Anugraha, Lampang Local Short and LCA 235 were contrasting for productivity per se traits and polymorphic at greater number of SSR loci. Two pairs of genotypes; Gouribidanur and LCA 960 and Utkal Awa and LCA 353 were not only polymorphic for highest number of SSR marker loci but also contrasting for fruit quality traits. These pairs of genotypes could serve as putative parents in breeding programme to generate variability and develop segregating populations for SSR marker-assisted mapping genomic regions controlling productivity per se and fruit quality traits.ThesisItem Open Access STUDIES ON SOFTWOOD GRAFTING IN JAMUN (Syzygium cumunii Skeel.)(University of Agricultural Sciences, Bangalore, 2010-07-15) JULIUS, UCHOI; Raju, B.The studies on softwood grafting in jam un was carried out at the division of Horticulture, Gandhi Krishi Vignana Kendra, UAS, Bangalore. The broad objectives of the investigation are to study the success rate of softwood grafting in Jamun using only Syzygium cumunii as a rootstock under Bangalore conditions over the m onth in different growing condition. A significant effect w as observed with different treatm ent (months of grafting), sub treatm ent ( growing conditions) on the observation recorded on the softwood grafts of Jam u n. Among the different treatm ents (m onths of grafting), the maximum value recorded on the param eter such as, num ber of sprouts, internodal length, graft height and graft success was 16.70 days, 2.79, 8.08 cm, 12.43cm and 90.50 per cent respectively during the m onth of January. The maximum num ber of days taken for sprouting, days taken for leaf emergence recorded w as 16.70 days & 25.46 days during the m onth of December. The maximum num ber of leaves (12.08) and branches per graft (4.45) was recorded during the m onth of March. Among the different sub treatment (growing conditions), The maximum number of days taken for leaf emergence (20.31 days) and num ber of leaves (11.77) was recorded when grafts were kept inside shade net house. The maximum num ber of sprouts (2.92) and number of branches (3.77) was recorded when grafts were kept under open (Natural shade) condition. The maximum internodal length (7.47cm), graft height (10.79cm), and Graft success (94%) was recorded when the grafts were kept inside the low cost poly house. The interaction effect also have a significant influence on alm ost all the parameters of the softwood graft. Thus the softwood grafting can be carried out successfully over the m onth under different growing conditions. However it was found that the maximum per cent of graft success were found to be the month of January when grafts were kept inside low cost poly house.ThesisItem Open Access STUDIES ON EFFECT OF GROWTH SUBSTANCES SPRAY, BUNCH SLEEVING AND UREA BUNCH STALK FEEDING ON IMPROVEMENT OF YIELD AND QUALITY ATTRIBUTES OF BANANA cv. Nanjanagudu Rasabale(University of Agricultural Sciences GKVK, Bangalore, 2010-07-25) NANDAN KUMAR, C. P.; Sathyanarayana, B. N.Banana is one of the major commercial fruit crops grown in tropics, subtropics and considered as one of the most economical source of food. The choice table cultivar “Nanjangudu Rasabale” comes under southern dry zone (6) of Karnataka and is a highly commercial cultivar. But nowadays the area under this cultivar is decelerating because of the serious problems such as Fusarium wilt and low productivity. In this regard, a field experiment was conducted to determine the effect of different pre harvest treatments on improvement of yield and quality of Nanjangudu rasable (AAB) at a farmer’s field in Bythanahalli, Nanjangudu taluk, Mysore district in 2009-2010. Experiment was laid in RCBD with 14 treatments and two replications. Gibberillic Acid (GA) and Sulphate of Potash bunch (SOP) were sprayed twice on bunch, urea was given as bunch stalk feeding and White High Density Polyethylene Transparent (WHDT) was covered immediately after bunch emergence. Results revealed that, at the time of harvest, GA (200 ppm) spray which helps in faster cell multiplication and division gave highest finger length and weight of 13.1 cm and 97.30 g respectively. Finger girth was highest at SOP 2% (13.0 cm) spray owing to the reason that potassium is involved in the process of phloem loading and unloading of photosynthetic assimilates. Bunch weight was highest in GA spray of 200 ppm (6.37 kg) followed by SOP at 2% (6.31 kg) and urea at 30 g/l (6.24). Days taken to harvest maturity were least in WHDT treatment (98 days) as a possible low diurnal temperature variation inside the covered bunch provides uniform growth condition for fruit. Regarding the quality of fruit, SOP 2% gave better shelf life (5.6 days) and TSS (26.1 0B). Total sugars were highest (26.08 %) in WHDT treatment. Acidity was least (0.30 %) in WHDT treatment probably owing to efficient conversion of acid to sugar in the treated fruits.ThesisItem Open Access MORPHOLOGICAL AND SSR MARKERS CHARECTERIZATION OF MANGO CLONES OF ALPHONSO(University of Agricultural Sciences GKVK, Bangalore, 2010-07-16) PRADEEP, M. P.; SATHYANARAYANA, B. N.In India, Alphonso is a well known, premier cultivar which occupies the prime position. In this cultivar few clones with distinct characters have been observed. The origin of all these clones is not known but these are indigenous to different parts of India. It is highly probable that the variation between the clones is due to eco-geographical conditions they have been exposed to and micro or macro level mutation from the parent cultivar Alphonso. The present study was conducted to ascertain differences among eight mango clones of Alphonso by using morphological and SSR marker approach during the year 2009 and 2010. Generally, a wide variation was noticed in Alphonso clones with respect to physical and chemical parameters of the fruit and percentage incidence and extent of spongy tissue disorder. The dendrogram based on 16 morphological marker data successfully distinguished all eight Alphonso clones from one another. Based on this analysis, Alphonso clones have been grouped in to two major clusters as ‘A’ and ‘B’. Cluster ‘A’ consisted of clones which are mainly collected from Bengaluru region and the clones collected from Dharwad District were placed in cluster ‘B’. The eight Alphonso clones and a Mallika variety were characterized at genomic level using 16 SSR primers. Among them only 2 primers were successful in establishing the differences between Alphonso clones and Mallika variety but failed to distinguish between the Alphonso clones. A dendrogram constructed by Ward’s method of clustering grouped all the Alphonso clones separately from Mallika variety. It can be concluded that, though the various Alphonso clones are morphologically different from each other but it could not be ascertained at genomic level by the presently employed set of SSR primers.ThesisItem Open Access STUDIES ON SEED VIABILITY, GERMINATION AND SEEDLING GROWTH OF MINOR FRUIT PLANTS(University of Agricultural Sciences GKVK, Bangalore, 2008-08-18) SMITHA, M. N.; NACHEGOWDA, V.The studies on seed viability, germination and seedling growth of seven minor fruit plants (Tamarind, Jack fruit, Syzygium cuminii, Syzygium jambos, Aonla, Annona and Wood apple) was studied at the Horticulture Research station, department of Horticulture, University of Agricultural Sciences, GKVK Bangalore during the year of 2006-07. Tamarind seed germination was highest when fresh seeds were sown (93%) and seedling height , number of leaves , stem girth ,root length were maximum at 90 days stored seeds. The vigour index of seedlings was found to be highest in fresh seeds. The seed germination in Jack was highest in fresh seeds (100%), the seedling height, number of leaves, stem girth, root length and vigour index was maximum in fresh seeds. The seed germination in Syzygium cumini was highest (100%) in fresh seeds, the seedling height, number of the leaves and root length was highest in 120 days stored seeds. The vigour index was found to be more in fresh seeds. The Syzyguim jambos the seed germination was highest in fresh seeds. The seedling height, number of the leaves, girth, root length, root girth, fresh and dry weight, vigour index were also varied with the storage period of seeds. Aonla seed germination was maximum (87 %) in fresh sown seeds. The seedling height, number of leaves, stem girth, root length, root girth, fresh and dry weight were varied with the storage period of seeds. Annona seed germination (67%) was highest in fresh seeds. The seedling height, number of the leaves, girth, root growth, root length, fresh and dry weight varied with the storage period of the seeds. The seed germination, seedling height, number of leaves, stem girth, root length, root girth, fresh and dry weight and vigour index in wood apple was also found to be highest in fresh seeds.ThesisItem Open Access EVALUATION OF CRACKING AND NON - CRACKING GENOTYPES OF JACK AND IDENTIFICATION OF SCAR MARKER RELATED TO FRUIT CRACKING(University of Agricultural Sciences GKVK, Bangalore, 2008-07-29) ROMEN SINGH, S.; NARAYANASWAMY, P.The investigations on “Evaluation of cracking and non-cracking genotypes of Jack and identification of SCAR marker related to fruit cracking” were carried out at the Plant Molecular Biology Laboratory, Division of Horticulture, UAS, GKVK, Bangalore-65, during the period 2007-2008. A survey was conducted in the orchards of Department of Horticulture, Farm Superintendent Office of UAS, Bangalore and State Department Farm, Tamaka at Kolar District. Study employed morphological and molecular markers for differentiating cracking and non-cracking type. Of all the cultivars used in the survey, the cultivar T-10 was the tallest. TCJ-03 produce highest number of fruits (58). The other parameters like stem thickness (120cm) and number of branches (20) were also highest in TCJ-03. The quality parameters in term of TSS was higher, acidity was low (0.04%) with moderate pectin (2.89%) in the cultivar TCJ-04 as compare to other. The RAPD analysis identified OPC-07 as the polymorphic primer showing band size of 810 bp as the polymorphic marker. The sequence data of fruit cracking character was analysed for its identity using BLASTX search for its homology with the sequence of a gene already recorded in the database of the NCBI, Bethesda, USA. Nucleotide sequence data reported here have been deposited in Gene Bank (NCBI) under the accession numbers – dbEST-ld User-ld GeneBank-Accn 56934622 Jackfruit 1 FG 228207 The sequence of the marker associated with fruit cracking as follows GTCCCGACGAGCAAAAGCTGGATTGGCAAAAAACTTGAGTTGCATATTACCGCGTTGGG TAAGGCATTATTAGCCTGGAAGACACGAGATGAACTGGATTATTTTTTAGAAGCACTCA CGTTAACTCCTCATACGCGCAATACATTTACCGATAAAAAATTGTTTCTGGAAGAATTAC AAAAAACACGCCTTCGGGGATGGGCCATAGACAACGAAGAATCAACCTATGGGGCGGT ATGTTTAAGTATGCCGGTATTCAATATGTATAGCAGAGTTAACTATGCAATCTCGCTTTC TGGCGATCCGGTAGTTTATTCAGGAAATAAGATAGACAGCTATCTGGAATTGCTCCGGA AATGCGCTGAGCAAATATCATATGGGCTGGGATACAGAAACGAAAATGAGCACTTACG AAAAGGAAACTGAGGTAATGAAAAAATTCAGCGGCATTATTCCACCGGTATCCAGCACG TTTCATCGTGACGGAACCCTTGATAAAAAGCAATGCGCGAAGTTGCCGACTTCCTGATTA ATAAAGGGGTCGACGGGCTGTTTTATCTGGGTACCGGTGGTGAATTTAGCCAAATGAAT ACAGCCCAGCGCATGGCACTCGCCGAAGAAGCTGTAACCATTGTCGACGGGCGAGTGCC CGGTATTGATTTGGCGTCGGTTCCCCTTCCACTGACGAAGCGGTCAAACTGGCGCAGCAT GCGCAAGCCTACGGCGCTGATGGTATCGTCGGGAC In the present study, these findings illustrated the usefulness of molecular markers as a tool for the crop improvement programs in jackfruit by identifying the marker associated with fruit cracking which can be used for identification of cracking types in the seedling stage itself.ThesisItem Open Access EFFECT OF TURFVIGOUR AND AGRIPLEX ON STRAWBERRY [Fragaria x ananassa Duch.] cv. ‘SUJATHA’(University of Agricultural Sciences GKVK, Bangalore, 2008-07-29) MOHAMMAD GULAB, OMARI.; Nachegowda, V.A study was undertaken during 2007-2008 at the Horticultural Research Station, University of Agricultural Sciences, GKVK, Bangalore to assess the effect of foliar application of TurfVigour and Agriplex at different concentrations on growth, yield, quality and nutrient uptake of strawberry cv. Sujatha. Foliar application of [TurfVigour 10 lit/ha + Agriplex 3.25 lit/ha] at 15 days interval along with recommended dose of fertilizers [40: 100: 150 kg NPK/ac] and organic manure [FYM 25 tonnes + neem cake 500 kg/ac] resulted in maximum plant growth viz., plant height [28.64 cm], plant spread [2184.99 cm2], number of leaves [159.05], index leaf area [40.16 cm2], number of runners per plant [25.94], leaf total chlorophyll [2.42 mg/g] chlorophyll ‘a’ [1.69 mg/g] and chlorophyll ‘b’ [0.73 mg/g] contents, maximum yield attributes viz., early flowering [120.50 days], full flowering [133.00 days], number of flower per plant [25.49] fruit set percentage [85.28%] number of fruits per plant [21.89], number of fruits per bed [414.13], fruit yield per plant [146.75g], fruit yield per bed [3.94 kg], fruit yield per hectare [8.47 t/ha], highest number of large sized A grade fruits [43.80] and fruit character viz., fruit weight [10.80 g], fruit volume [14.92 ml], polar diameter of fruit [4.97 cm], transverse diameter of fruit [3.67 cm], were highest. The quality parameter viz., TSS [8.76 0Brix], total sugars [8.200%], reducing sugars [ 2.367%], non – reducing sugars [5.937%] were maximum and titratable acidity [0.700%] was lowest leaf nutrient content viz., nitrogen [2.95%], phosphorous [0.57%], potassium [2.97%], calcium [4.25%] and micro nutrients such as iron [167.95 ppm], manganese [183.25 ppm], zinc [95.75 ppm], copper [45.75 ppm], were recorded maximum in the above mentioned treatment. Foliar spray of TurfVigour 10 lit/ha and Agriplex 3.25 lit/ha at 15 days interval can be adopted in commercial cultivation of strawberry.ThesisItem Open Access EFFECT OF GROWTH REGULATOR ON ROOTING AND SPROUTING OF POMEGRANATE (Punica granatum L.) CUTTING UNDER GREENHOUSE CONDITION(University of Agricultural Sciences GKVK, Bangalore, 40773) ABDUL RASOOL, ATAYI; KRISHNA MANOHAR, RThe present investigation to know the effect of IBA on rooting and sprouting in basal and mid cuttings of pomegranate (Punica granatum L) was carried out during year 2010-2011 at the Department of Horticulture, Gandhi Krishi Vignana Kendra (GKVK), University of Agricultural Sciences, Bangalore, Karnataka, India. Observation on the vegetative parameters are significantly higher with the treatment containing 1000 ppm IBA concentration (T1) in basal cuttings with regard to days taken for sprouting (14.33 days), number of sprouting per cutting (6.18), length of shoot (7.59 cm), number of leaves (22.30), number of roots (20.46), length of longest roots (6.41cm) as well as survival percentage (82.36 %) as compared to control (18.00 days), number of sprouting per cutting (3.81), length of shoot (5.21 cm), number of leaves (16.26), number of roots (17.16), length of longest roots (4.14cm) and survival percentage (46.49 %) respectively). Among the cuttings, basal cuttings recorded statistically significant difference in shoot and root parameters from first to seventh week after planting than mid cuttings. Among the different growth regulator concentrations, IBA @ 1000 ppm induced better root and shoot from first to seventh week against control. The maximum net profit (Rs.118.75) could be obtained in same concentration from 75 cuttings.ThesisItem Open Access PLUG PRODUCTION AND EVALUATION OF DIFFERENT SOILLESS SYSTEMS AND SUBSTRATES FOR CULTIVATION OF STRAWBERRY (Fragaria ananassa Duch.) cv. ‘STRAWBERRY FESTIVAL’(University of Agricultural Sciences GKVK, Bangalore, 40840) FRAIDOON; MURTHY, B N SThe investigation was carried out at the Division of Fruit Crops, Indian Institute of Horticultural Research (IIHR) Bangalore, India during 2010-11 on strawberry cv. ‘Strawberry Festival’ to find out the effect of explant and media on plug growth. The studies were extended to determine the suitable system and media for quality fruit production in soilless culture. The explant (first and second order nodes and runner tip) did not affect most of biometric characters of plug. However, the highest per cent establishment (89) was observed from first order node. Higher number of roots (12.33) and leaves (5.48), larger crown diameter (7.32 mm) and higher shoot and root fresh and dry weight were observed when plugs produced in coco peat + perlite (1:1, v/v). The results of soilless culture of strawberry indicated that plants performed best in Open-trough as compared to Lay-Flat-Bag and Verti- Gro systems. Maximum leaf area (2478.66 cm2), crown diameter (33.75 mm), highest shoot (60.97 g) and root (16.50g) fresh weight, highest shoot (21.10 g) and root (5.74 g) dry weight, highest fruit weight per plant (281.83 g) and marketable fruits (78.33 %) recorded in Open-trough. Further, highest number of leaves (37.16), leaf area (2199.82 cm2), larger crown diameter (30.50 mm), fruit weight per plant (209.92 g) and marketable fruits (61.91%) was recorded when plants were grown using 60% coco peat +40% perlite (v/v). Maximum leaf area (2002.64 cm2), crown diameter (31.00 mm), fruit weight per plant (194.60 g), marketable fruits (63.33) and highest TSS (10.51 °B) and lowest acidity (0.81 %) was observed in first tier as compared to lower section of the Verti-Gro system.