Thumbnail Image

Birsa Agricultural University, Ranchi

Browse

2013 - 20153
Reset filters
Subject: Animal Genetics and Breeding × End date: 2019 × Start date: 2013 × Type: Thesis ×
Reset filters

Search Results

Now showing 1 - 3 of 3
  • Thumbnail Image
    ThesisItemOpen Access
    GENETIC ARCHITECTURE OF BLACK BENGAL GOAT IN CONTEXT TO ITS FECUNDITY
    (Birsa Agricultural University, Kanke, Ranchi, Jharkhand, 2013) KUMAR, VIVEK; Singh, L. B.
    The present study was carried out on Black Bengal goats which is prolific meat purpose breed of India. Animals were maintained at Instructional Small Ruminant Farm, Ranchi Veterinary College, B.A.U., Ranchi. In this investigation, goat population was screened for polymorphism of FecB gene. A study of association of different variants with different reproductive traits and absolute body weights at different stages of growth was also done. With the primers having forward and reverse base sequence as 5'-CCAGAGGACAATAGCAAAGCAAA-3' and 5'-CAAGATGTTTTC ATGCCTCATCAACAGGTC-3', PCR products obtained were subjected to polyacrylamide gel electrophoresis for the detection of Single Strand Conformational Polymorphism (SSCP). As a result, three different SSCP variants were found which were designated as AA, AB and BB. The highest genotype frequency was observed for AB (0.38), which was followed by BB (0.33) and AA (0.29). Least-square analysis of variance showed significant (P<0.01) effect of genotype on litter size at birth. The result revealed that highest litter size at birth was found to be 02.06±00.08 for genotype BB, which differed significantly (P<0.01) from that of genotype AA (01.14±00.08) and genotype AB (01.27±00.07). Further, it was found that genotype had significant (P<0.01) effect on litter size at weaning. The highest litter size at weaning was found to be 01.81±00.06 for genotype BB, which differed significantly from that of genotype AA (01.00±00.08) and genotype AB (01.12±00.06). There was non-significant effect of genotype on age at first kidding, service period, kidding interval and gestation period. Moreover, there is significant (P<0.01) effect of genotype on body weight at birth. The least square mean of body weights at birth for genotype BB (01.17±00.03 kg) was significantly lower than that of genotype AA (01.43±00.03 kg) and genotype AB (01.36±00.02 kg). The different genotype were non-significantly associated with absolute body weight at 4-week, 8-week, 12-week, 24-week, 36-week and 48-week. Nucleotide sequences of the allelic variants were also analyzed. The DNA sequence showing polymorphism observed were used to identify SNPs. Principal SNP was found at 78 position of gene sequence, which shows transition of Adenine (AA genotype) to Guanine (BB genotype). On the basis of this investigation, following conclusion were observed: 1. The PCR-SSCP analysis of FecB gene revealed the polymorphic pattern of genotypes in Black Bengal Goat. It suggests that flow of FecB mutation was present in Black Bengal Goat. 2. There was significant association of different polymorphic variants of FecB gene with the litter size at birth and at weaning and body weight at birth.
  • Thumbnail Image
    ThesisItemOpen Access
    GENETIC ARCHITECTURE OF CHHOTANAGPURI SHEEP IN CONTEXT TO ITS FECUNDITY
    (Birsa Agricultural University, Kanke, Ranchi, Jharkhand, 2013) ORAON, THANESH; Singh “Dron”, D. K.
    The present study was conducted to study polymorphism of FecB genes and ascertain genotypes of Chhotanagpuri lambs on the basis of alleles of FecB gene with objectives to estimate the effects of genotypes and some non- genetic factors on growth in terms of absolute body weights of lambs from birth to 52-week of age as well as variation in growth rate in terms of average daily gain in weight during different periods of growth. Attempts were also made to study relationship of ewe’s weight at lambing with growth of their lambs as well as among body weights at different stages of growth from birth to 52-week of age. Regression equations with their coefficient of determination were also developed to predict body weight at later stages of life on the basis of earlier weights. The findings of this study are being summarized as follows: (1) Six single strand conformation polymorphism variants of FecB gene were obtained at Locus-1 and Locus-2. (2) AT Locus-1, the genotype frequency of AA was highest (0.424) followed by AB (0.326) and BB (0.250) .revealed that the frequency of A and B alleles were 0.587 and 0.413, respectively. (3) Locus-2, the genotype frequency of CD was higher (0.402) followed by CC (0.381) and DD (0.217), indicating that the frequency C and D were 0.587 and 0.418, respectively. (4) Genotypes at Locus-1 had significant effect on body weights of lambs from 8th week of age to 52nd week of age, though the variations in birth weight and weight at 4th week due to it was not significant. (5) Lambs with BB genotype at Locus-1 had better growth rate up to 52-wk of age than those with AA and AB genotypes. (6) Growth of lambs remains unchanged due to genotypes at Locus 2, though lambs of CC genotype had better growth than CD and DD genotypes. (7) Body weights of lambs from 4th week onwards varied significantly due to dam’s weight at lambing. (8) Lambs of heavier dams continued to weigh more than those of lighter dams till 52- wk of age. (9) Birth weight of lambs had significant effect on their growth up to 52-week of age. Lambs born with higher birth weight at grow faster rate than those born having lower birth weight particularly during pre-weaning period i.e up to 12-week of age. (10) Average Daily Gain (ADG) in body weight of lambs was maximum (81.64±3.83 g/day) irrespective of genotypes. (11) ADG declined with the advancement in age. (12) Lambs with BB genotype at Locus had better growth rate in terms of ADG than those of AA and AB at this locus (13) Lambs with higher birth weight had better ADG particularly during pre-weaning period. (14) Dam’s weight at lambing had positive and significant phenotypic association with body weight of their lambs up to 52 – week of age. (15) Phenotypic association among body weights at various stages of growth were positive and significant, though the magnitude of relationship declined with the increase in gap between two weights taken. Regression study revealed that the body weight at growth could be predicted with moderately higher accuracy on the basis of preceding weight The following conclusions have been drawn: (1) Chhotanagpuri lambs with BB genotypes should be selected for better growth. (2) Breeding program should be designed to increase the frequency of ‘B’ allele among individuals in a flock of Chhotanagpuri sheep. (3) Lambs with high birth weight should be cared properly particularly after weaning at 12-wk of age for better post-weaning growth. (4) Keeping in view the positive association of dam’s weight at lambing on growth of their lambs up to 52-week of age the ewes particularly during advance stage of pregnancy should be fed properly and cared properly for improving birth weight of lambs and its growth. (5) Lambs could be selected on the basis of weight at at birth and 12-wk of age for better growth and more meat yield. (6) Polymorphism of FecB gene should be studied with a large number of primers to derive valid conclusion in context of fecundity.
  • Thumbnail Image
    ThesisItemOpen Access
    TLR6 GENE POLYMORPHISM AND ITS ASSOCIATION WITH IMMUNE RESPONSE AND DIFFERENT ECONOMIC TRAITS IN PIGS.
    (2015) KUMARI, NANDANI; SINGH, L. B.
    In the most recent decade, the population of swine has declined to approximately 12 million head from a high of 14 million in 2003, as indicated by the 17th Livestock Census of India. Industry sources suggest that this decline may be due to animal disease outbreaks. Hence, livestock breeders and geneticists now focus attention towards proper utilization of disease resistance aspect of our live-stocks. Among the different genes involved in immune response of different livestock particularly pig, TLR (TOLL-LIKE RECEPTOR) gene is of prime importance in innate immunity response. Polymorphisms and/or differences in the production of immune molecules, such as TLRs, have a profound influence on responses to a wide range of pathogens and are associated with resistance and susceptibility to diseases (Lazarus et al. 2002). So far, 13 members of the TLR family were identified in mammals (Beutler, 2005). Studies with dominant negative receptors have shown that TLR6 cooperates with TLR2 to recognize peptidoglycan and the yeast cell wall particle. Furthermore, TLR6 deficient mice were reported to be hyporesponsive to mycoplasma macrophage-activating lipopeptide-2 kD (MALP-2), a diacylated lipoprotein, suggesting that and TLR6 coordinate the response to this ligand. Hence TLR6 have the potential to become candidate gene for marker assisted selection for disease resistance that could be exploited by breeding strategies. Keeping this in view, the present investigation was carried on with two objectives, first to find out polymorphism in porcine TLR6 gene in Tamworth, Desi and T&D groups of pig and secondly to estimate the association between SNPs in TLR6 gene with the economic trait namely body weight at birth. A total of 48 pigs from three genetic groups namely Tamworth, Desi and T&D maintained at Pig farm Ranchi veterinary College were utilized for this investigation. Observations of weight at birth(Birth weight) of all the 48 animal were taken under controlled managerial conditions. The antibody response to SRBC was assessed by haemagglutination test (according to procedure of Siegel & Gross 1980). Further blood (5ml.) was collected along with anticoagulant from each of the experimental animal. Genomic DNA was isolated and purified from white blood cells using proteinase-K digestion and standard phenol -chloroform extraction as per the standard protocol described by Sambrook,et.al.,(1989).Nine pairs of synthetic oligonucleotide/primers(One forward and another backward) were required to prime DNA amplification to see the polymorphism in TLR6. To explore genetic polymorphism in TLR-6 gene, amplified PCR products were subjected for SSCP through polyacrylamide gel electrophoresis. Silver staining method was described by Bassam, et. al.,(1991). The data were statistically analyzed with available computer software SPAB and Least Square Analysis Harvey’s model(1990). Haplotyping based on the bands obtained were analyzed and confirmatory sequencing was done from Xcleris lab. Further Phylogenetic analysis was done to construct the evolutionary tree based on the sequence on Sus Scrofa TLR6 gene using BLAST software (NCBI) website. Polymorphism With the 1st primer having forward and reverse base sequences as TTTGGATGCCTAGCAAAGATA and GGGATGGCACTTTTCCAGAT respectively, six different haplotypes namely A, B, C, D, E, & F were obtained. Under 2nd primer with forward and reverse base pairs as GCAGCTGACGGTTTTGAGA & GGGATGGCACAAGATTGTCT respectively, three different haplotypes namely A, B & C were observed. The third primer of TLR 6 with forward and reverse base sequences as TCGGTTAAGAGAGTGTAGGGTGTTT and GGTACCTGAGGAGCGTAA respectively, five haplotypes were obtained and they were designated as A, B, C, D, E, and F. In case of fourth primer having forward and reverse base sequences as TTGGCCCAAACCTGTAGAAT and CCAACCCAAGTGCAAT, no amplification was obtained despite repeated PCR amplification. Even the optimization didn't yield any result for this primer. The 5th primer having forward and reverse base sequences of GTCCTGAGGTACCAAGCACA and TGGAAAGGCTGCTAAAGGAA respectively yielded four haplotypes namely A, B, C, and D. For 6th primer with forward base sequence as GAAAATTGCACTTGGGTTGG and reverse base sequence as ACGGAAGTCCTTGAGCAGAG, four haplotypes coded as A, B,C and D were found. Under the 7th primer with forward and reverse as TTCCTTTAGCAGCCTTTCCA and GAAGGCATGGAACTGGAGAG, a total of six haplotypes namely A, B, C, D, E and F were obtained. In case of 8th primer having forward and reverse base sequences as CTGGCATTGGCTCTTACCAT and TAAGTTCGTGTGCCATGAG, a total of four haplotypes were obtained. They were termed as A, B, C, & D. In case of 9th primer having forward and reverse base sequences CATTGAGAAAAGCTACAA and GGAGGTTATGGAGGTATCGTC three haplotypes namely A, B, and C were obtained. Haplotype frequency : For the first primer (TLR6-1) gene, in Desi, the highest genotype frequency (35.71%) was observed for haplotypes A&B and in Tamworth population haplotype B (57.41%) had the highest frequency while for T&D population, haplotype A had the maximum (45.00%) frequency. For the 2nd primer (TLR6-2) in the Desi population, haplotype A (92.86% ),in Tamworth, haplotype A (71.42), and for T&D Haplotype C (75.00%) had the highest genotype frequency.For the 3rd primer(TLR6-3), in case of Desi, Tamworth and T&D ,haplotypes B (57.41%), haplotype B (78.57 % ), haplotype D (65.00%) had maximum values respectively. For the 5th primer (TLR6-5), in case of Desi population, haplotype A (57.14%) in Tamworth, haplotypes A and C ( 35.71% ) and in T&D, haplotype C (60.00%) had maximum genotype frequency. Haplotype A (85.71%) , haplotype D (71.43%) and haplotype C (45.00% ) had the maximum value for Desi. Tamworth, and T&D, respectively for the 6th primer (TLR6-6). In case of 7th primer(TLR6-7) for Desi population, haplotype A had maximum value of 64.29% .Haplotype B with 50.00% had the highest values of genotype frequency for Tamworth. For T&D, haplotypes B and D had a genotype frequency of 50.00%. For 8th primer (TLR6- 8),Haplotypes B and C had highest genotype frequency of 28.57% Tamworth had the highest genotype frequency of 57.14% for haplotype B. For T&D haplotypes C&A had the highest value of 35.00%. Haplotype A (85.71% ), haplotype A (71.43%) and A (55.00%) had the highest values respectively for Desi, Tamworth and T&D for the 9th primer(TLR6-9). Association of TLR6 gene polymorphism with different economic traits: Polymorphic patterns of TLR6-1 gene indicated that SNP genotypes were significantly associated body weight at birth. Polymorphic patterns of TLR6-2 gene indicated SNP genotypes Haplotypes had non-significant effect on traits under study. Polymorphic patterns of TLR6-3 indicated that haplotypes had non-significant effect on other traits except for body weight at 42- day. Polymorphic patterns of TLR6-5 indicated that haplotypes for primer -5 (TLR6-5) had nonsignificant effect on all the traits. Polymorphic patterns of TLR6-6 indicated that haplotypes had non-significant effect on all the traits under study. Polymorphic patterns of TLR6-7 indicated that out of all the traits under study, the haplotypes had significant effect on body weight at birth and body weight at 42-day and on body weight at 56-day.Polymorphic patterns of TLR6-8 indicated that haplotypes had non-significant effect on all the traits under study.Polymorphic patterns of TLR6-9 indicated that out of all the traits under study, the haplotypes had significant effect on litter weight at weaning. Impact of piglet’s immune response on growth of piglets : Piglet’s titre had significant effect on body weight at 42-day. High responder piglets had heavier birth weight and body weights at 7-day, 14-day, 28-day, 42-day and also at 56-day of age than those of low responder piglets. Impact of Piglet’s immune response on Body weights gain at different ages. High responder piglets had heavier body weight gain during birth and 7-day, 14 and 28-days and 28 and 42-day.While high responders had lower body weight gains for 7 and 14-day and 42 and 56-day. Impact of piglet’s immune response on reproductive traits: Effect of piglet titre on litter size at birth was non-significant with a mean of value of 09.649 ± 09.1357 for low responders and 09.107 ± 08.2528 for high responders respectively. Nonsignificant effect of piglet titre on litter weight at birth was reported with the mean value being 10.649 ± 00.9326kg and 11.301 ± 01.0323 kg respectively for low responders and for high responders . Piglet titre had non-significant effect on litter size at weaning. Non significant effect of piglet titre on litter weight at weaning was reported with low responders and high responders having the mean value of 75.040 ± 09.1357kg and 72.067 ± 08.2528kg respectively. Effect of genetic groups on reproductive traits: The four reproductive traits for study were litter size at birth, litter weight at birth, litter size at weaning and litter weight at weaning . Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and di ffered non-significantly from TxD (10.727 ± 01.0906 kg). Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and differed non-significantly from TxD (10.727 ± 01.0906kg). Effect of genetic groups (Table 4.30) on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Least squares analysis of variance showed the significant effect of genetic groups on litter size at weaning (p≤0.05). The result revealed that significantly highest litter size at Weaning was found to be 11.247 ± 01.0057 in Tamworth followed by TxD (08.535 ± 00.7217) and then lowest value for Desi was 05.556 ± 01.5019.Least squares analysis of variance indicated the nonsignificant effect of genetic groups on litter weight at weaning. TLR6 gene sequence analysis under different primers : The PCR products representing different SSCP patterns in swine resource population of present study were directly sequenced using DNA sequencing service (Xcelris Hyderabad). The nucleotide sequence alignments were carried out using alignment tools, viz. Clustal W (DNA star Inc. USA) and BLAST to reveal single base variations. These allelic variants in the sequence of nucleotide were analyzed. The DNA sequences showing polymorphism were used to identify SNPs. Under the TLR6-1 primer, principal SNPs were found at positions 59, 61, 66, 75, 155, 189, 288 and 371 of nucleotide bases. With respect to the second primer of TLR6 gene, principal SNPs were found at positions 66,69,71,72,73,77,79,402,512,519,520,521 and 522 of the nucleotide bases. Third fragment of the TLR6 exhibited the principal SNPs at positions 19, 20, 22, 25, 28, 29, 330, 347, 384, of the nucleotide bases. The fifth primer of the TLR6 exhibited the principal SNPs at positions 61, 64, 65, 70, 225, 235, 275, 285, 289, 302 and 303 of the nucleotide bases. Principal SNPs were observed at positions5,6,7,8,34,63,64,136,179,185,186,187,188,189,190,191,192,197,203-208,222, 208, 367, 388, 408, 409 and 410 . 4, 5, 6, 7, 54, 59, 262, 317, 397 and 406 were the main positions at which SNPs were observed in case7th primer. In 8th primer the principal SNPs were found at 7, 8, 9, 13, 14, 59, 61, 62, 130, 148,149,154, 155, 156, 380, 395, 400, 403, for the 8th primer. The ninth primer of TLR6 gene exhibited the principal SNPs at positions 40,41, 42, 46, 47, 48,49, 52, 381, 382, 390, 393 and 394 of the nucleotide bases . Correlation of piglet titre with growth traits and reproductive traits: Correlation of Piglet titre was found to be positive in all other cases except for body weight (kg) at 14-day and weight gain (Kg) between 7-14 day. It was negative for these two growth traits. The correlation was significant only in case of Body weight at 42-day (P ≤ 0.05). Correlation of piglet titre with reproductive traits was found to be non-significant . Litter size at birth was positively correlated with HA titre Piglet titre was negatively correlated with all other traits i.e. Litter weight at birth and Litter size at weaning and Litter weight at weaning. Phylogenetic studies : In the current study, there were nine different primers of TLR 6 gene out of which eight were used for phylogenetic studies based on sequence data using the NCBI BLAST (as the 4th primer did not yield any result on amplification), the details were explained under following heads. Phylogenetic studies based on TLR6 gene fragment were studied figure showed the genetic distance among different species of animals with reference sequence ICI / 56329 of TLR 6 gene fragment. The sequence was found nearest to sus scrofa mRNA and TLR 6, TLR1 and TLR10.It was found to be most distant from Bubali bubalis and nearer to Equus Caballus than other domestic animals. The genetic distance among the different species of animals with reference sequence (ICI / 62869) gene fragment. It is nearest to TLR6, TLR1 and TLR10.Phylogeny based on this sequence showed that similar to it other domestic animals like buffalo, sheep and goat seems to have evolved from Equus Caballus . Phylogenetic studies based on TLR 6-3 gene fragments were studied and presented as Figure 4.39 which indicated the genetic distance among different species of animals with reference sequence ( ICI / 36573) of TLR 6-3 gene fragment .This fragment although was nearest to TLR 6 mRNA, it did not show any nearness to TLR1 and TLR10. With respect to TLR 6-5 gene fragment, phylogenetic studies were done. The genetic distance among the different species of animals with reference sequence ICI / 40627 of TLR6-5 gene fragment from which TLR6 mRNA and TLR 6,TLR 1and TLR10 seems to have evolved. Further based on this sequence sus scrofa is equidistant from other domestic animals w.r.t phylogeny. The genetic distance among the different species of animals with reference sequence ICI / 36573 of TLR6–6 gene seems to have evolved from Felis catus along with other domestic animals. Further the TLR6 gene fragment shows that sus scrofa is nearest to Equus Caballus and almost equidistant from other domestic animals like Bubalas bubalis, ovis aris and Bos indicus . As found according to the analysis, the genetic distance among the different species of animals with reference sequence ICI / 35303 of TLR 6-7 gene fragment. The fragment based phylogeny shows that swine is nearest to Equus caballusand most distant from ovis aries and capra hircus. Genetic distance among the different species of animals with reference sequence ICI / 37879 of TLR 6-8 gene fragment. The phylogeny revealed that it was nearest to Equus caballus. Phylogenetic analysis based on TLR6 gene fragment was studied and compiled as Figure 4.44 which contained the genetic distance among the different species of animals with reference sequence ICI / 25503 of TLR 6-9 gene fragment. It was found to be nearest to Equus Caballus and most distant from Bos Indicus and Bos Taurus among all. The PCR-SSCP analysis of TLR - 6 gene revealed the polymorphic pattern of genotypes in Swine. Presence of Different Haplotypes was evidence of allelic variants and hence polymorphism and mutations at different loci which could be studied and exploited for population and selection studies in swine. Significant association of TLR-6 gene polymorphism with the Humoral Immune response against SRBCs was observed. High responder piglets against SRBCs performed better than the low responders with respect to growth indicating its usefulness for designing breeding and selection strategies to develop lines with high immunity. The phylogenetic tree revealed the relative genetic distance of different germplasms of Swine under study. Based on the result, TLR 6 gene was found to be closer to TLR1 and TLR10. Further the evolutionary tree for majority of primers showed Sus Scrofa to be nearest to Equus caballus on the basis of sequence under consideration. The DNA sequences showing polymorphism were used to identify SNPs. SNPs were found at various positions in case of all the primers The SNPs on further study could help unravel many mysteries related to oncogeny and other disorders in the swine.