TLR6 GENE POLYMORPHISM AND ITS ASSOCIATION WITH IMMUNE RESPONSE AND DIFFERENT ECONOMIC TRAITS IN PIGS.
Loading...
Date
2015
Authors
Journal Title
Journal ISSN
Volume Title
Publisher
Abstract
In the most recent decade, the population of swine has declined to approximately 12 million head
from a high of 14 million in 2003, as indicated by the 17th Livestock Census of India. Industry
sources suggest that this decline may be due to animal disease outbreaks. Hence, livestock
breeders and geneticists now focus attention towards proper utilization of disease resistance
aspect of our live-stocks.
Among the different genes involved in immune response of different livestock
particularly pig, TLR (TOLL-LIKE RECEPTOR) gene is of prime importance in innate
immunity response. Polymorphisms and/or differences in the production of immune molecules,
such as TLRs, have a profound influence on responses to a wide range of pathogens and are
associated with resistance and susceptibility to diseases (Lazarus et al. 2002). So far, 13
members of the TLR family were identified in mammals (Beutler, 2005).
Studies with dominant negative receptors have shown that TLR6 cooperates with TLR2
to recognize peptidoglycan and the yeast cell wall particle. Furthermore, TLR6
deficient mice were reported to be hyporesponsive to mycoplasma macrophage-activating
lipopeptide-2 kD (MALP-2), a diacylated lipoprotein, suggesting that and TLR6 coordinate the
response to this ligand. Hence TLR6 have the potential to become candidate gene for marker
assisted selection for disease resistance that could be exploited by breeding strategies.
Keeping this in view, the present investigation was carried on with two objectives, first
to find out polymorphism in porcine TLR6 gene in Tamworth, Desi and T&D groups of pig and
secondly to estimate the association between SNPs in TLR6 gene with the economic trait namely
body weight at birth.
A total of 48 pigs from three genetic groups namely Tamworth, Desi and T&D
maintained at Pig farm Ranchi veterinary College were utilized for this investigation.
Observations of weight at birth(Birth weight) of all the 48 animal were taken under controlled
managerial conditions. The antibody response to SRBC was assessed by haemagglutination test
(according to procedure of Siegel & Gross 1980).
Further blood (5ml.) was collected along with anticoagulant from each of the experimental
animal. Genomic DNA was isolated and purified from white blood cells using
proteinase-K digestion and standard phenol -chloroform extraction as per the standard
protocol described by Sambrook,et.al.,(1989).Nine pairs of synthetic
oligonucleotide/primers(One forward and another backward) were required to prime DNA
amplification to see the polymorphism in TLR6. To explore genetic polymorphism in TLR-6
gene, amplified PCR products were subjected for SSCP through polyacrylamide gel
electrophoresis. Silver staining method was described by Bassam, et. al.,(1991). The data were
statistically analyzed with available computer software SPAB and Least Square Analysis
Harvey’s model(1990). Haplotyping based on the bands obtained were analyzed and
confirmatory sequencing was done from Xcleris lab. Further Phylogenetic analysis was done to
construct the evolutionary tree based on the sequence on Sus Scrofa TLR6 gene using BLAST
software (NCBI) website.
Polymorphism
With the 1st primer having forward and reverse base sequences as
TTTGGATGCCTAGCAAAGATA and GGGATGGCACTTTTCCAGAT respectively, six
different haplotypes namely A, B, C, D, E, & F were obtained. Under 2nd primer with forward
and reverse base pairs as GCAGCTGACGGTTTTGAGA & GGGATGGCACAAGATTGTCT
respectively, three different haplotypes namely A, B & C were observed. The third primer of
TLR 6 with forward and reverse base sequences as TCGGTTAAGAGAGTGTAGGGTGTTT
and GGTACCTGAGGAGCGTAA respectively, five haplotypes were obtained and they were
designated as A, B, C, D, E, and F. In case of fourth primer having forward and reverse base
sequences as TTGGCCCAAACCTGTAGAAT and CCAACCCAAGTGCAAT, no
amplification was obtained despite repeated PCR amplification. Even the optimization didn't
yield any result for this primer. The 5th primer having forward and reverse base sequences of
GTCCTGAGGTACCAAGCACA and TGGAAAGGCTGCTAAAGGAA respectively yielded
four haplotypes namely A, B, C, and D. For 6th primer with forward base sequence as
GAAAATTGCACTTGGGTTGG and reverse base sequence as
ACGGAAGTCCTTGAGCAGAG, four haplotypes coded as A, B,C and D were found. Under
the 7th primer with forward and reverse as TTCCTTTAGCAGCCTTTCCA and
GAAGGCATGGAACTGGAGAG, a total of six haplotypes namely A, B, C, D, E and F were
obtained. In case of 8th primer having forward and reverse base sequences as
CTGGCATTGGCTCTTACCAT and TAAGTTCGTGTGCCATGAG, a total of four haplotypes
were obtained. They were termed as A, B, C, & D. In case of 9th primer having forward and
reverse base sequences CATTGAGAAAAGCTACAA and GGAGGTTATGGAGGTATCGTC
three haplotypes namely A, B, and C were obtained.
Haplotype frequency :
For the first primer (TLR6-1) gene, in Desi, the highest genotype frequency (35.71%) was
observed for haplotypes A&B and in Tamworth population haplotype B (57.41%) had the
highest frequency while for T&D population, haplotype A had the maximum (45.00%)
frequency. For the 2nd primer (TLR6-2) in the Desi population, haplotype A (92.86% ),in
Tamworth, haplotype A (71.42), and for T&D Haplotype C (75.00%) had the highest genotype
frequency.For the 3rd primer(TLR6-3), in case of Desi, Tamworth and T&D ,haplotypes B
(57.41%), haplotype B (78.57 % ), haplotype D (65.00%) had maximum values respectively. For
the 5th primer (TLR6-5), in case of Desi population, haplotype A (57.14%) in Tamworth,
haplotypes A and C ( 35.71% ) and in T&D, haplotype C (60.00%) had maximum genotype
frequency. Haplotype A (85.71%) , haplotype D (71.43%) and haplotype C (45.00% ) had the
maximum value for Desi. Tamworth, and T&D, respectively for the 6th primer (TLR6-6). In
case of 7th primer(TLR6-7) for Desi population, haplotype A had maximum value of 64.29%
.Haplotype B with 50.00% had the highest values of genotype frequency for Tamworth. For
T&D, haplotypes B and D had a genotype frequency of 50.00%. For 8th primer (TLR6-
8),Haplotypes B and C had highest genotype frequency of 28.57% Tamworth had the highest
genotype frequency of 57.14% for haplotype B. For T&D haplotypes C&A had the highest
value of 35.00%. Haplotype A (85.71% ), haplotype A (71.43%) and A (55.00%) had the
highest values respectively for Desi, Tamworth and T&D for the 9th primer(TLR6-9).
Association of TLR6 gene polymorphism with different economic traits:
Polymorphic patterns of TLR6-1 gene indicated that SNP genotypes were significantly
associated body weight at birth. Polymorphic patterns of TLR6-2 gene indicated SNP genotypes
Haplotypes had non-significant effect on traits under study. Polymorphic patterns of TLR6-3
indicated that haplotypes had non-significant effect on other traits except for body weight at 42-
day. Polymorphic patterns of TLR6-5 indicated that haplotypes for primer -5 (TLR6-5) had nonsignificant
effect on all the traits. Polymorphic patterns of TLR6-6 indicated that haplotypes had
non-significant effect on all the traits under study. Polymorphic patterns of TLR6-7 indicated
that out of all the traits under study, the haplotypes had significant effect on body weight at birth
and body weight at 42-day and on body weight at 56-day.Polymorphic patterns of TLR6-8
indicated that haplotypes had non-significant effect on all the traits under study.Polymorphic
patterns of TLR6-9 indicated that out of all the traits under study, the haplotypes had significant
effect on litter weight at weaning.
Impact of piglet’s immune response on growth of piglets :
Piglet’s titre had significant effect on body weight at 42-day. High responder piglets had heavier
birth weight and body weights at 7-day, 14-day, 28-day, 42-day and also at 56-day of age than
those of low responder piglets.
Impact of Piglet’s immune response on Body weights gain at different ages.
High responder piglets had heavier body weight gain during birth and 7-day, 14 and 28-days and
28 and 42-day.While high responders had lower body weight gains for 7 and 14-day and 42 and
56-day.
Impact of piglet’s immune response on reproductive traits:
Effect of piglet titre on litter size at birth was non-significant with a mean of value of 09.649 ±
09.1357 for low responders and 09.107 ± 08.2528 for high responders respectively. Nonsignificant
effect of piglet titre on litter weight at birth was reported with the mean value being
10.649 ± 00.9326kg and 11.301 ± 01.0323 kg respectively for low responders and for high
responders . Piglet titre had non-significant effect on litter size at weaning. Non significant effect
of piglet titre on litter weight at weaning was reported with low responders and high responders
having the mean value of 75.040 ± 09.1357kg and 72.067 ± 08.2528kg respectively.
Effect of genetic groups on reproductive traits:
The four reproductive traits for study were litter size at birth, litter weight at birth, litter size at
weaning and litter weight at weaning .
Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth
with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with
05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these
two different non -significantly between the two.
Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth
with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and di ffered
non-significantly from TxD (10.727 ± 01.0906 kg).
Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth
with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with
05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these
two different non -significantly between the two.
Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth
with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and differed
non-significantly from TxD (10.727 ± 01.0906kg).
Effect of genetic groups (Table 4.30) on litter size at birth was found to be significant (p≤0.05).
Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi
with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034
and these two different non -significantly between the two.
Least squares analysis of variance showed the significant effect of genetic groups on litter size at
weaning (p≤0.05). The result revealed that significantly highest litter size at Weaning was found
to be 11.247 ± 01.0057 in Tamworth followed by TxD (08.535 ± 00.7217) and then lowest
value for Desi was 05.556 ± 01.5019.Least squares analysis of variance indicated the nonsignificant
effect of genetic groups on litter weight at weaning.
TLR6 gene sequence analysis under different primers :
The PCR products representing different SSCP patterns in swine resource population of present
study were directly sequenced using DNA sequencing service (Xcelris Hyderabad). The
nucleotide sequence alignments were carried out using alignment tools, viz. Clustal W (DNA
star Inc. USA) and BLAST to reveal single base variations. These allelic variants in the sequence
of nucleotide were analyzed. The DNA sequences showing polymorphism were used to identify
SNPs. Under the TLR6-1 primer, principal SNPs were found at positions 59, 61, 66, 75, 155,
189, 288 and 371 of nucleotide bases. With respect to the second primer of TLR6 gene, principal
SNPs were found at positions 66,69,71,72,73,77,79,402,512,519,520,521 and 522 of the
nucleotide bases. Third fragment of the TLR6 exhibited the principal SNPs at positions 19, 20,
22, 25, 28, 29, 330, 347, 384, of the nucleotide bases. The fifth primer of the TLR6 exhibited the
principal SNPs at positions 61, 64, 65, 70, 225, 235, 275, 285, 289, 302 and 303 of the
nucleotide bases. Principal SNPs were observed at
positions5,6,7,8,34,63,64,136,179,185,186,187,188,189,190,191,192,197,203-208,222, 208, 367,
388, 408, 409 and 410 . 4, 5, 6, 7, 54, 59, 262, 317, 397 and 406 were the main positions at
which SNPs were observed in case7th primer. In 8th primer the principal SNPs were found at 7, 8,
9, 13, 14, 59, 61, 62, 130, 148,149,154, 155, 156, 380, 395, 400, 403, for the 8th primer. The
ninth primer of TLR6 gene exhibited the principal SNPs at positions 40,41, 42, 46, 47, 48,49, 52,
381, 382, 390, 393 and 394 of the nucleotide bases .
Correlation of piglet titre with growth traits and reproductive traits:
Correlation of Piglet titre was found to be positive in all other cases except for body weight (kg)
at 14-day and weight gain (Kg) between 7-14 day. It was negative for these two growth traits.
The correlation was significant only in case of Body weight at 42-day (P ≤ 0.05). Correlation of
piglet titre with reproductive traits was found to be non-significant . Litter size at birth was
positively correlated with HA titre Piglet titre was negatively correlated with all other traits i.e.
Litter weight at birth and Litter size at weaning and Litter weight at weaning.
Phylogenetic studies :
In the current study, there were nine different primers of TLR 6 gene out of which eight were
used for phylogenetic studies based on sequence data using the NCBI BLAST (as the 4th primer
did not yield any result on amplification), the details were explained under following heads.
Phylogenetic studies based on TLR6 gene fragment were studied figure showed the genetic
distance among different species of animals with reference sequence ICI / 56329 of TLR 6 gene
fragment. The sequence was found nearest to sus scrofa mRNA and TLR 6, TLR1 and TLR10.It
was found to be most distant from Bubali bubalis and nearer to Equus Caballus than other
domestic animals. The genetic distance among the different species of animals with reference
sequence (ICI / 62869) gene fragment. It is nearest to TLR6, TLR1 and TLR10.Phylogeny based
on this sequence showed that similar to it other domestic animals like buffalo, sheep and goat
seems to have evolved from Equus Caballus . Phylogenetic studies based on TLR 6-3 gene
fragments were studied and presented as Figure 4.39 which indicated the genetic distance among
different species of animals with reference sequence ( ICI / 36573) of TLR 6-3 gene fragment
.This fragment although was nearest to TLR 6 mRNA, it did not show any nearness to TLR1 and
TLR10. With respect to TLR 6-5 gene fragment, phylogenetic studies were done. The genetic
distance among the different species of animals with reference sequence ICI / 40627 of TLR6-5
gene fragment from which TLR6 mRNA and TLR 6,TLR 1and TLR10 seems to have evolved.
Further based on this sequence sus scrofa is equidistant from other domestic animals w.r.t
phylogeny. The genetic distance among the different species of animals with reference sequence
ICI / 36573 of TLR6–6 gene seems to have evolved from Felis catus along with other domestic
animals. Further the TLR6 gene fragment shows that sus scrofa is nearest to Equus Caballus and
almost equidistant from other domestic animals like Bubalas bubalis, ovis aris and Bos indicus .
As found according to the analysis, the genetic distance among the different species of animals
with reference sequence ICI / 35303 of TLR 6-7 gene fragment. The fragment based phylogeny
shows that swine is nearest to Equus caballusand most distant from ovis aries and capra hircus.
Genetic distance among the different species of animals with reference sequence ICI / 37879 of
TLR 6-8 gene fragment. The phylogeny revealed that it was nearest to Equus caballus.
Phylogenetic analysis based on TLR6 gene fragment was studied and compiled as Figure 4.44
which contained the genetic distance among the different species of animals with reference
sequence ICI / 25503 of TLR 6-9 gene fragment. It was found to be nearest to Equus Caballus
and most distant from Bos Indicus and Bos Taurus among all. The PCR-SSCP analysis of TLR -
6 gene revealed the polymorphic pattern of genotypes in Swine. Presence of Different
Haplotypes was evidence of allelic variants and hence polymorphism and mutations at different
loci which could be studied and exploited for population and selection studies in swine.
Significant association of TLR-6 gene polymorphism with the Humoral Immune response
against SRBCs was observed. High responder piglets against SRBCs performed better than the
low responders with respect to growth indicating its usefulness for designing breeding and
selection strategies to develop lines with high immunity. The phylogenetic tree revealed the
relative genetic distance of different germplasms of Swine under study. Based on the result,
TLR 6 gene was found to be closer to TLR1 and TLR10. Further the evolutionary tree for
majority of primers showed Sus Scrofa to be nearest to Equus caballus on the basis of sequence
under consideration. The DNA sequences showing polymorphism were used to identify SNPs.
SNPs were found at various positions in case of all the primers The SNPs on further study could
help unravel many mysteries related to oncogeny and other disorders in the swine.
Description
TLR6 GENE POLYMORPHISM AND ITS ASSOCIATION WITH IMMUNE RESPONSE AND DIFFERENT ECONOMIC TRAITS IN PIGS.