Loading...
Anand Agricultural University, Anand
Anand Agricultural University (AAU) was established in 2004 at Anand with the support of the Government of Gujarat, Act No.(Guj 5 of 2004) dated April 29, 2004. Caved out of the erstwhile Gujarat Agricultural University (GAU), the dream institution of Sardar Vallabhbhai Patel and Dr. K. M. Munshi, the AAU was set up to provide support to the farming community in three facets namely education, research and extension activities in Agriculture, Horticulture Engineering, product Processing and Home Science. At present there seven Colleges, seventeen Research Centers and six Extension Education Institute working in nine districts of Gujarat namely Ahmedabad, Anand, Dahod, Kheda, Panchmahal, Vadodara, Mahisagar, Botad and Chhotaudepur
AAU's activities have expanded to span newer commodity sectors such as soil health card, bio-diesel, medicinal plants apart from the mandatory ones like rice, maize, tobacco, vegetable crops, fruit crops, forage crops, animal breeding, nutrition and dairy products etc. the core of AAU's operating philosophy however, continues to create the partnership between the rural people and committed academic as the basic for sustainable rural development. In pursuing its various programmes AAU's overall mission is to promote sustainable growth and economic independence in rural society. AAU aims to do this through education, research and extension education. Thus, AAU works towards the empowerment of the farmers.
Browse
16 results
Search Results
ThesisItem Open Access SINGLE NUCLEOTIDE EXTENSION ASSAY FOR CHARACTERIZATION OF DGAT1 LOCUS IN MEHSANA BUFFALO(AAU, Anand, 2009) PATIL, RAHUL CHAITRAM; Joshi, C. G.India, home ground of water buffalo (Bubalus bubalis) has 11 recognized breeds adapted to different climatic zones. The immense importance of this species due to contribution of more than 55 per cent to the total milk production and making country as number one milk producer in the world. Tremendous variation in production traits provokes buffalo genomic research to identify genes underlying the variability of milk production traits that could be useful in effective breeding programs. Present study was carried out with enormous interest in genotyping of Diacylglycerol acyltransferase 1 (DGATl) locus of Mehsana buffalo. The DGATl gene plays crucial role in triglyceride synthesis in the mammary gland which is proved by mice lacking both copies of DGATl gene are completely devoid of milk secretion and became a functional candidate gene for lactation traits. In the present study, five SNPs of DGATl gene of Indian water buffalo (GenBank-accession number DQ886485) with nucleotide position 1179, 1195 and 3096 (intron 1), 5545 (intron 2) and 6067 (intron 3) were selected for screening 64 Mehsana buffalo samples with the help of single nucleotide extension assay. According to principle of assay, unlabeled primers are hybridized to the DNA template just adjacent to respective SNP site and primer is extended by one base by DNA polymerase with fluorescence-labeled ddNTP terminators and further separated by capillary electrophoresis. Genomic DNA samples of Mehsana buffalo were subjected to DGATl specific PCR amplification using appropriate primer pairs and PCR products of expected size were successfully amplified at annealing temperature dO^C and then electrophoresed on 2 per cent agarose along with the MassRular Low range DNA ladder. Purified PCR products were subjected to single nucleotide primer extension with respective target DNA template and optimized under thermal cycling condition of armealing at 60°C and extension at 65°C for 25 cycles. Along with test samples, positive and negative control was also processed. All the SNaPshot PCR products then treated with CIAP and subjected to capillary electrophoresis on ABI PRISM 310 Genetic Analyzer along with LIZ 500 size standard for further analysis. The type of nucleotide present confirmed by the signal colour observed and length of final product obtained, by comparing with the size standard. The final length of each test primer extension product was judged by repeatedly running a single primer reaction and then determined consistently observed length of particular primer. Further (multiplex SNaPshot reaction was carried out using multiple primers with optimum concentration to determine the position and type of SNPs in single reaction. All the samples were found homozygous in both groups for SNP 1179, 1195 and 3096 with genotype AA, CC and CC respectively. This indicated that these alleles were fixed. Both the variants at nucleotide position 5545 (C and T) and 6067 (T and C) were observed. Allelic frequency was checked for both these SNPs and were found 0.85 (CC) and 0.15 (TT) for SNP 5545 while 0.57 (CC) and 0.43 (TT) for SNP 6067. Statistical analysis showed no significant association of these five SNPs with milk production traits like milk yield and milk fat percentage. All studied SNPs belonged to intronic regions however, may not be involved in manifestation of the traits.ThesisItem Open Access EFFECT OF IGF-I,IGF-II AND TGF.β3 GENE EXPRESSION ON FEED CONSUMPTION AND EGG PRODUCTION IN SYNTHETIC WHITE LEGHORN(AAU, Anand, 2009) PANCHAL, JAYESHKUMAR RAMESHCHANDRA; Savaliya, F. P.The present study was carried out to compare the levels of expression of IGF-I, IGF-II and TGF-β3 gene in liver of 24 Synthetic White Leghorn chicken from four groups (six bird/group) with different level of feed consumption and egg production and to estimate correlation between levels of gene expression on various economic traits by quantitative real time PCR using GAPDH as endogenous control. The relative expression ratio (fold of induction) for groups was determined in relation to a calibrator which was represented by the smallest signal detectable for that specific gene. There were significant (p < 0.05) differences in IGF-I expression level in four groups. Maximum level of expression was in HL group (13.81 ±3.84a) followed by, LL (13.70 ± 6.07a), LH (4.74 ± 0.91ab), and HH (2.88 ± 0.47b HL and LL groups have significantly (p<0.05) higher expression over the HH and LH. However, there were no significant differences in expression between HL and LL and between HH and LH. There were no significant differences in expression level of IGF-II and TGF-β3 in four groups. The correlation of IGF-I with Age at Sexual maturity, body weight at all ages were non significant. The correlation of IGF-1 with egg weight at 32 weeks of age was positive, high and significant (p < 0.05), whereas, with egg weight at 40, 56, 64 and 72 weeks of age were non significant. The correlations of IGF-I with egg production were negative, high and significant (p < 0.05), except with egg production up to 40 weeks of age which was non significant. The correlation between IGF-I and Total Feed consumption during 51-60 weeks of age was non significant. The correlation of IGF-II with Age at Sexual maturity, body weight at 16, 20, 32, 40, 56, 64 and 72 weeks of age were non significant. The correlation between IGF-lI and egg weight at 32, 40, 56, 64 and 72 weeks of age were non significant. The correlation of IGF-II with egg production up to 72 weeks of age was negative, high and significant (p < 0.05), while, the correlation at other ages were non significant. The correlation between IGF-II and Total Feed consumption during 51-60 weeks of age was non significant. The correlation of TGF-β3 with Age at Sexual maturity, body weight at all ages, feed consumption during 51-60 weeks and egg production at all ages were non significant. The correlation between TGF-β3 and egg weight were non significant. Feed consumption per egg (g/egg) was positive, high and significant (p<0.05) with IGF-I, while non significant with IGF-II and TGF-β3. Present finding suggests that correlation of IGF-I gene with egg production were Significant and negative while, positive with body weight at different ages and increase as age advances.ThesisItem Open Access Study of Pituitary transcription factor, Insulin like growth factor, Leptin, Oxidized low density lipoprotein receptor 1 and Proteases inhibitor gene loci in Mehsana buffaloes(AAU, Anand, 2009) Deshpande, Manisha Ramesh; Rank, D. N.The present work was carried out to study the polymorphism in Pituitary transcription factor (PITl exon 6), Insulin like growth factor (IGFl exon 4), Leptin (exon 2), Oxidized low density lipoprotein receptor 1 (OLRl 3'UTR) and proteases inhibitor gene (PI exon 2) loci in Mehsana buffaloes through PCR-RFLP and sequencing in Mehsana buffaloes. DNA extraction was carried out by John's method from sixty blood samples of non related Mehsana buffaloes from the animals registered under progeny testing programme of Dudhsagar Research and Development Association (DURDA), Mehsana. Locus specific primers were used for PCR amplification for each of five loci. The fragment of 451bp of Pit-1 was amplified by PCR, using the primers reported by Renaville et al. (1997) and digested with restriction enzyme Hinfl. All the samples showed identical restriction pattern consisting of one site at 207 bp obtaining two fiiagments of 207bp and 244 bp. All the animals revealed monomorphic pattern with BB genotype. This result indicated no polymorphism existing in Mehsana buffalo at Pitl exon 6 locus as revealed by Hinfl RFLP. The study revealed only one allele B fixed in Mehsana buffalo with allele frequency 1.0. PCR products of representative samples were purified and cloned in pTZ57R/T vector of InsT/Aclone TM kit. Ligated recombinant vector was transformed in competent E. coli (DH5-a) cells. Recombinant plasmids were obtained and used for cycle sequencing. Sequencing revealed G—>T variation between cattle and buffalo at 283 nucleotide position. The fragment of 320 bp of IGF Iwas amplified by polymerase chain reaction, using the primers reported byDierkes e^a/.(1999) and digested with Ecol30I. On screening the IGF/Ecol30I polymorphism in Mehsana buffalo, all the animals revealed monomorphic pattern with three bands of 34, 127, and 159 bp (B allele) indicating two RE sites at 127 and 161 bp position. The investigation revealed B allele fixed in Mehsana buffaloes. As there is no polymorphism, association analysis is not warranted. PCR products of 320bp of IGF-1 (exon 4) from representative samples were purified and cloned in pTZ57R/T vector. Recombinant plasmids were obtained and used for cycle sequencing. The nucleotide sequence variation between cattle and buffalo was present at four nucleotide positions i.e. 35bp, 102bp, 132bp, 257 bp. The fragment of 331 bp of leptin gene loci was amplified by PCR, using the primers reported by Haegeman et al. (2000). Amplified products were digested with HphI and electrophoresed on 2% agarose. All the samples showed identical restriction pattern with 331 bp fiugment only. On screening the Leptia/HphI polymorphism in Mehsana buffalo one genotype AA was observed indicating allele A fixed in Mehsana buffalo. Representative sample PCR products of 331bp of leptin (exon 2) was purified and cloned in pTZ57R/T vector. Recombinant plasmids were obtained and used for cycle sequencing. The nucleotide sequence variation between cattle and buffalo was presentat six nucleotide positions i.e. 100,112,119,135,185,321. OLRl 3' UTR region was explored for Pst 1 RFLP in Mehsana buffalo. The primers reported by Khatib et al. (2006) for Bos taunts could not amplify the region in Mehsana buffaloes. Hence, new primer sets were designed using Bioinformatic tools, Primer 3.0 and Primer Express softwares (http://www.genome.wi.mit.edu/cgi bin/primer/primer3_www.cgi) on the basis of gene sequence available in the data base NW_174132.2. A 288 bp fragment of OLR gene loci was amplified by PCR, using the designed primers and digested with Pst 1. It has aPst 1 site at 215 bp and produced two fragments of 215 and 73 bp. Representative sample PCR products of 288 bp (3'UTR) was purified and cloned in pTZ57R/T vector. Recombinant plasmids were obtained and used for cycle sequencing. The nucleotide sequence variation between cattle and buffalo was present at nine nucleotide positions i.e. 85,91,116,129,151,168,171,217,240. The fragment of 448 bp of PI gene loci was amplified by PCR, using the primers reported by Khatib et al. (2005) and digested with restriction enzyme SfaNI. SfaNI digestion of PI axon 2 gene fragments revealed monomorphic pattern with appearance of three bands of 242bp, 124bp, 82 bp (B allele) in all the samples. Representative sample PCR products of 448 bp of PI (exon 2) was purified and cloned in pTZ57R/T vector. Recombinant plasmids were obtained and used for cycle sequencing. The nucleotide sequence variation between cattle and buffalo was present at ten nucleotide positions i.e. 110,141,146,170,236,257,277,306,350,396. None of the polymorphic site reported in cattle for PITl, IGFl, Leptin, OLRl and PI could be verified in buffalo. Genomic nucleotide sequences of PITl, IGFl, Leptin, OLRl and PI was submitted to Genbank of NCBI database. Bankit online sequence submission tool was used for submission of sequences to Genbank. 1. GQ385224: Bubalus bubalis POU domain class 1 transcription factor 1 (PITl) gene, exon 6 and partial cds. 2. GQ385225 : Bubalus bubalis serpin peptidase inhibitor clade A member 1 (SERPINAl) gene, partial cds. 3. GQ385226: Bubalus bubalis oxidized low density lipoprotein receptor 1 (OLRl)gene,3'UTR. 4. GQ385227: Bubalus bubalis insulin-like growth factor 1 (IGFl) gene, exon 4 and partial cds. 5. GQ385228: Bubalus bubalis leptin gene, exon 2 and partial cds.ThesisItem Open Access Genotyping of Single Nucleotide Polymorphisms at DGAT1 gene intron-15,16 and3'UTR in Mehsana buffalo by direct sequencing(AAU, Anand, 2009) Patel, Jigneshkumar Vishnubhai; Rank, D. N.The DGAT1 gene is a key enzyme in triacylglycerol synthesis in the manunary gland, and it has emerged as a strong candidate gene for the variation in milk fat percentage and milk yield. Nineteen SNPs are reported in DGAT1 gene in buffalo. In the present study three out of 19 SNPs (SNP 8087, SNP 8259 and SNP 8426) were genotyped and their association in DGAT1 with milk fat percentage and milk yield was ascertained in Mehsana buffalo. Top ranked 25 and bottom ranked 25 animals with respect to milk yield (MY) and milk fat percentage (MF%), out of 130 Mehsana buffalo under field progeny testing programme were utilized for the study. DGAT1 748 bp region was amplified using F - CTCCCCCGCAGACACTTC and R - GCACAGCACTTTATTGACACATTC primer pairs. PCR amplification of 748 bp fragment was confirmed by agarose gel electrophoresis. PCR products were purified by perfectprep PCR clean up 96 kit and subjected to cycle sequencing followed by capillary electrophoresis on ABI PRISM ™ 310 Genetic Analyzer for fiirther analysis. The nucleotide sequences of the DGAT1 gene obtained using forward and reverse primers were assembled and a consensus sequence obtained was aligned with published sequences of the DGAT1 gene. SNP 8087 was found to be monomorphic in all the animals. Allele 'C was fixed in Mehsana buffalo population. SNP 8259 was found to be polymorphic and allelic frequencies for G and A allele were 0.58 and 0.42 in high milk yield group and 0.80 and 0.20 in low milk yield group, respectively. In high and low fat percentage group, allelic frequencies for G and A allele were 0.76 and 0.52 and 0.24 and 0.48, respectively. However, 'G' had apparently higher frequency in low milk yield and high fat % groups, giving some clue that it could be responsible for high MF and low MY. Like wise, SNP 8426 was also found to be polymorphic and allelic frequencies for C and T allele were 0.68 and 0.32 in high milk yield group and 0.48 and 0.52 in low milk yield group, respectively. Among high and low fat percentage groups, the same were 0.46, 0.54 and 0.62, 0.38 respectively. There was higher frequency of 'C allele in high milk yield and low fat percent groups while higher frequency of 'T' allele in low milk yield and high fat percent groups. This also indicated that the SNP could be involved in MY and MF. However, statistical analysis showed that there was no significant difference in milk yield and milk fat % among SNP 8259 genotypes GG, GA and AA and SNP 8426 genotypes CC, CT and TT indicating that there was no association of these SNPs with milk production traits such as milk yield and milk fat per cent. AC/AC, GC/GC, GT/GT, AC/AC, GC/GC and GT/GT were the major genotypic combination at these SNPs. Statistical analysis also did not reveal any significant difference in milk yield or milk fat % among various genotype combinations of SNPs 8259 and 8426, further confirming that, there was no association of these SNPs with milk production traits such as milk yield and milk fat %. Thus, these SNPs do not have any functional significance with milk production traits.ThesisItem Open Access Effect of IGF-I, IGF-II, GH and TGF-β3 gene Polymorphism on Feed Consumption and Egg production in Synthetic White Leghorn(AAU, Anand, 2009) THAKER, MITULKUMAR DHANSUKHRAI; Savaliya, F. P.Two hundred and fifty pullets of Synthetic White Leghorn were housed at 16 weeks of age in individual California cage system at Department of Poultry Science, College of Veterinary Science and A.H., Anand. Various principal production traits AFE, Feed consumption during 51-60 weeks, Egg production during 51-60 weeks and up to 72 weeks, BW20, BW40, BW64, BW72, EW32, EW40, EW64 and EW72 were recorded on individual birds. On the basis of feed consumption and egg production during 51-60 weeks the birds were categorized i.e., High feed consumption and High egg production (HH), Low feed consumption and High egg production (LH), High feed consumption and Low egg production (HL) and Low feed consumption and Low egg production (LL) groups. From each group 10 birds were utilized for the present study. Blood DNA was extracted from these 40 birds by John's method with some modification. Chicken gene specific primers were used for amplification of IGF-I, IGF-II, GH and TGF-pa genes loci. Amplified PCR product of IGF-I, IGF-II, GH and TGF-P3 genes were digested with Hinf-I, Hin I-II, Msp-I and Bsel-I RE, respectively for RFLP analysis. Polymorphic pattern were found in IGF-I and IGF-II genes, while for TGF-Ps gene all the samples were monomorphic. MSP-I restriction enzyme didn't cut amplified PCR product for GH gene, which might be due to mutation in line. Genotypic frequency of AA, BB and AB genotypes were 0.10, 0 and 0.90 in HH, 0.40, 0.30 and 0.30 in LH, 0.30, 0.10 and 0.60 in HL, 0.70, 0.20 and 0.10 in LL groups, respectively for IGF-I gene. Genotypic frequency of AA, BB and AB genotypes were 0.70, 0.10 and 0.20 in HH, 0.20, 0.10 and 0.70 in LH, 0.60, 0.10 and 0.30 in HL, 0.30, 0 and 0.70 in LL groups, respectively for IGF-II genotype. In TGFPa gene only LL genotype was observed with allelic frequency of L and B alleles being 1.0 and 0 respectively. Significant (p<0.05) difference was observed between IGF-I genotypes and EN51.60. AB genotype had significantly (p<0.05) higher EN51.60 as compared to AA and BB genotypes, suggesting in heterozygous condition birds had given more egg production. IGF-II genotypes were found to be significant (p<0.05) for BW64. AA and AB genotypes differed significantly (p<0.05) as compared to BB genotype for BW64. IGF-I and IGF-II genotypes were found to be non significantly different for TEN72, BW at 20, 40, 72 weeks, EW at 32, 40, 64, 72 weeks, FC/egg51-60 and AFE. In IGF-I Group X Genotype interaction was significant (p<0.05) only for DFC51-60, where as it was non significant for all traits in IGF-II. In IGF-I group effect was found to be significant for EN51-60, TEN72, FC/egg51-6o, BW40, EW (at 32, 64, 72 weeks), where as it was non significant for other traits. In IGF-II group effect was significant (p<0.05) for DFC51-60, EN51-60, TEN72, FC/egg51-60, BW (at 40 and 64 weeks) and EW (at 40, 64, 72 weeks), while it was non significant for other traits.ThesisItem Open Access CHARACTERIZATION OF MEHSANA BUFFALO AT DGAT1 LOCUS(AAU, Anand, 2009) PATEL, KETANKUMAR SHAMALBHAI; Vataliya, P. H.Diacylglycerol-0- acyltransferasel (DGATI) is a microsomal enzyme that catalyzes the final step in triglyceride synthesis by using diacylglycerol and fatty acyl CoA as substrates. DGATI gene, located in the proximal region of chromosome 14 in cattle, has been identified as a strong candidate gene for the QTL for milk production traits. Single Nucleotide Polymorphism (SNP) variation in DGAT1 gene in association with milk yield and milk Fat % in buffaloes might be a useful tool to select the high producing animals at early stage of life. The present study was undertaken to screen Mehsana buffalo at three SNP positions (3057, 3627 and 8426) in DGATJ gene using PCR- RFLP and to correlate these SNPs with milk yield and milk Fat %. Genomic DNA was extracted from blood samples of 100 Mehsana buffalo females collected under a project "Parentage Verification of Progeny Test Daughters" in collaboration with DURDA, Dudhsagar Dairy, Mehsana, Gujarat. Of these 100 genomic DNA samples, 25 samples were from high milk producing animals (2213- 3010 liters/lactation), 25 from low milk producing (836- 1513 liters/lactation), 25 from high milk fat % (5.7- 6.4 %) and 25 from low milk fat % (7.7- 8.6 %) animals J Three PCR primer pairs viz., DGAT1-5 (F- 5' TTg gCA ggT TgT AgC ATg Ag 3' and R- 5' gCA Agg CCT CCA gTT TTg TA 3') specific to intron 1 which included nt position 3057, DGAT1-6 (F- 5' ggC CTC TCC CCT TAC AAA AC 3' and R- 5' CAC ACA CCA ATT CAg gAT gC 3') specific to part of intron 1 and exon 2 which included nt position 3627 and DGATl-\6 (F- 5' gAT AgT ggg CCg CTT CTT C and R- 5' TgC ACA gCA CTT TAT TgA CAC A 3') specific to exon 17-3' downstream which included nt position 8426, were used for amplification of specific DNA. Amplified products were visualized as a single compact band of expected size of 503 bp, 661 bp and 413 bp, respectively under UV light by gel documentation system. PCR products for screening SNP positions 3057, 3627 and 8426 were restriction digested by NmuCI, Smal and Ehel RE respectively. Presence of restriction site for NmuCI RE at SNP position 3057 was inferred as 'A' allele, otherwise as 'G' allele. For SNP positions 3627 and 8426, presence of restriction sites for Smal and Ehel RE, respectively were inferred as 'C allele, otherwise as 'T' allele. r Frequency of 'A' allele was predominant (0.96 for high milk producing, 0.94 for low milk producing, 0.96 for high fat % producing and 1.00 for low fat % producing groups) for SNP position 3057. Frequency of 'C allele was predominant (0.78 for high milk producing, 0.78 for low milk producing, 0.84 for high fat % producing and 0.82 for low fat % producing groups) for SNP position 3627. Frequency of 'T' allele was predominant (0.68 for high milk producing, 0.64 for low milk producing, 0.76 for high fat % producing and 0.52 for low fat % producing groups) for SNP position 8426. Results indicated that no particular variant with higher frequency was present in any specific group) There was no significant difference (P > 0.05) for any variant of these three SNPs with respect to milk yield and milk Fat %. Therefore, there were no significant associations of these three SNPs with milk yield and milk fat % in Mehsana buffaloes.ThesisItem Open Access GENETIC ANALYSIS OF PRODUCTION AND REPRODUCTION TRAITS OF HOLSTEIN FRIESIAN CATTLE ON AN ORGANIZED FARM(AAU, Anand, 2008) CHANDULAL, PATEL ASHiSH KUMAR; Vataliya, P HThe body weight, production and reproduction records of Holstein Friesian cattle were collected from H.F. farm, Anand Agricultural University, Anand from 1992 - 2007. Total 278 body weight records at birth weight, body weight at 3, 6 and 12 months under 32 sires and daily milk production records for 209 lactations from 130 cattle were collected. Data up to fifth lactations were collected for each animal. The records were analyzed using least squares analysis procedures incorporating Period, Seasons of calving, parity etc. non-genetic factors in statistical model. The Mixed Model Least-Squares and Maximum Likelihood Computer Programme PC 2 Version of Harvey (1990) was used to estimate genetic parameters from adjusted data by paternal half sib correlation method. Gamma function of Statistical Packages for Social Sciences programme (S.P.S.S. version 10.1) was used for fitting lactation curve. Persistency was calculated on the weekly records of the milk yield. The least squares means for birth weight (BWQ), body weights at 3 (BW3), 6 (BWg) and 12 months (BW,2) were 34.90 ± 0.45, 75.53 ± 0.60, 144.43 ± 1.01 and 248.20 ± 1.24 kg, respectively. Body weights at 3, 6 and 12 months were significantly affected by period of calving and seasons of calving but birth weight was not significantly affected by period and seasons of calving. The calves born in summer season had significantly (P < 0.05) higher body weight at 3, 6 and 12 months than calves born in other season. The parity of dam had no significant effects on body weight at all ages. Sex effects were significant on body weights at all ages and the male calves were heavier than females at all ages. The heritability estimates of BWQ, BW3, BWe and BW12 were 0.028 ± 0.13, 0.201 ± 0.152, 0.096 ±0.15 and 0.113±0.15, respectively.ThesisItem Open Access MOLECULAR GENETIC STUDY OF LEPTIN GENE IN GIR CATTLE AND MEHSANA BUFFALO(Anand Agricultural University, Anand, 2008) NILAM BHARATSINH JHALA; Dr. P. H. VataliyaLeptin is a 16-kDa protein synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility, and immune functions. Leptin binds to a receptor mainly localized on neuropeptide Y-neurons. The bovine leptin gene is organized into three exons separated by two introns, of which only 2 exons (exon-2 and 3) are translated into proteins. Variation in the exonic region of a gene may lead to changes in amino acids which alter the expressed protein. Therefore, the present study was undertaken to detect polymorphism at respective restriction sites in Leptin gene exon-3 by PCR-RFLP, SSCP, and sequencing in Gir cattle and Mehsana buffalo breedsThesisItem Open Access GENETIC ANALYSIS OF PRODUCTION AND REPRODUCTION TRAITS OF HOLSTEIN FRIESIAN CATTLE ON AN ORGANIZED FARM(Anand Agricultural University, Anand, 2008) ASHISH KUMAR CHANDULAL PATEL; Dr. P.H. VataliyaThe body weight, production and reproduction records of Holstein Friesian cattle were collected from H.F. farm, Anand Agricultural University, Anand from 1992 – 2007. Total 278 body weight records at birth weight, body weight at 3, 6 and 12 months under 32 sires and daily milk production records for 209 lactations from 130 cattle were collected. Data up to fifth lactations were collected for each animal. The records were analyzed using least squares analysis procedures incorporating Period, Seasons of calving, parity etc. non-genetic factors in statistical model. The Mixed Model Least-Squares and Maximum Likelihood Computer Programme PC 2 Version of Harvey (1990) was used to estimate genetic parameters from adjusted data by paternal half sib correlation method. Gamma function of Statistical Packages for Social Sciences programme