Genotyping of Single Nucleotide Polymorphisms at DGAT1 gene intron-15,16 and3'UTR in Mehsana buffalo by direct sequencing
Loading...
Date
2009
Authors
Journal Title
Journal ISSN
Volume Title
Publisher
AAU, Anand
Abstract
The DGAT1 gene is a key enzyme in triacylglycerol synthesis in the manunary gland, and it has emerged as a strong candidate gene for the variation in milk fat percentage and milk yield. Nineteen SNPs are reported in DGAT1 gene in buffalo. In the present study three out of 19 SNPs (SNP 8087, SNP 8259 and SNP 8426) were genotyped and their association in DGAT1 with milk fat percentage and milk yield was ascertained in Mehsana buffalo. Top ranked 25 and bottom ranked 25 animals with respect to milk yield (MY) and milk fat percentage (MF%), out of 130 Mehsana buffalo under field progeny testing programme were utilized for the study. DGAT1 748 bp region was amplified using F - CTCCCCCGCAGACACTTC and R - GCACAGCACTTTATTGACACATTC primer pairs. PCR amplification of 748 bp fragment was confirmed by agarose gel electrophoresis. PCR products were purified by perfectprep PCR clean up 96 kit and subjected to cycle sequencing followed by capillary electrophoresis on ABI PRISM ™ 310 Genetic Analyzer for fiirther analysis. The nucleotide sequences of the DGAT1 gene obtained using forward and reverse primers were assembled and a consensus sequence obtained was aligned with published sequences of the DGAT1 gene. SNP 8087 was found to be monomorphic in all the animals. Allele 'C was fixed in Mehsana buffalo population. SNP 8259 was found to be polymorphic and allelic frequencies for G and A allele were 0.58 and 0.42 in high milk yield group and 0.80 and 0.20 in low milk yield group, respectively. In high and low fat percentage group, allelic frequencies for G and A allele were 0.76 and 0.52 and 0.24 and 0.48, respectively. However, 'G' had apparently higher frequency in low milk yield and high fat % groups, giving some clue that it could be responsible for high MF and low MY. Like wise, SNP 8426 was also found to be polymorphic and allelic frequencies for C and T allele were 0.68 and 0.32 in high milk yield group and 0.48 and 0.52 in low milk yield group, respectively. Among high and low fat percentage groups, the same were 0.46, 0.54 and 0.62, 0.38 respectively. There was higher frequency of 'C allele in high milk yield and low fat percent groups while higher frequency of 'T' allele in low milk yield and high fat percent groups. This also indicated that the SNP could be involved in MY and MF. However, statistical analysis showed that there was no significant difference in milk yield and milk fat % among SNP 8259 genotypes GG, GA and AA and SNP 8426 genotypes CC, CT and TT indicating that there was no association of these SNPs with milk production traits such as milk yield and milk fat per cent. AC/AC, GC/GC, GT/GT, AC/AC, GC/GC and GT/GT were the major genotypic combination at these SNPs. Statistical analysis also did not reveal any significant difference in milk yield or milk fat % among various genotype combinations of SNPs 8259 and 8426, further confirming that, there was no association of these SNPs with milk production traits such as milk yield and milk fat %. Thus, these SNPs do not have any functional significance with milk production traits.
Description
Keywords
ANIMAL GENETICS AND BREEDING, A STUDY