Thumbnail Image

Anand Agricultural University, Anand

Anand Agricultural University (AAU) was established in 2004 at Anand with the support of the Government of Gujarat, Act No.(Guj 5 of 2004) dated April 29, 2004. Caved out of the erstwhile Gujarat Agricultural University (GAU), the dream institution of Sardar Vallabhbhai Patel and Dr. K. M. Munshi, the AAU was set up to provide support to the farming community in three facets namely education, research and extension activities in Agriculture, Horticulture Engineering, product Processing and Home Science. At present there seven Colleges, seventeen Research Centers and six Extension Education Institute working in nine districts of Gujarat namely Ahmedabad, Anand, Dahod, Kheda, Panchmahal, Vadodara, Mahisagar, Botad and Chhotaudepur AAU's activities have expanded to span newer commodity sectors such as soil health card, bio-diesel, medicinal plants apart from the mandatory ones like rice, maize, tobacco, vegetable crops, fruit crops, forage crops, animal breeding, nutrition and dairy products etc. the core of AAU's operating philosophy however, continues to create the partnership between the rural people and committed academic as the basic for sustainable rural development. In pursuing its various programmes AAU's overall mission is to promote sustainable growth and economic independence in rural society. AAU aims to do this through education, research and extension education. Thus, AAU works towards the empowerment of the farmers.

Browse

2008 - 200923
Reset filters
Subject: Animal Biotechnology × End date: 2009 × Start date: 2008 ×
Reset filters

Search Results

Now showing 1 - 9 of 23
  • Thumbnail Image
    ThesisItemOpen Access
    Application of Real Time PCR assay for quantifying bacterial density in the rumen of Goats fed tannin rich diets
    (AAU, Anand, 2009) SONI, PRASHANTKUMAR SURESHBHAI; Pandya, P. R.
    India possess second largest population of Goats. Grazing goats are the backbone of most of the world's marginal land enterprises. They are capable of utilizing effectively a vast variety of plant species and vegetation types including unconventional feeds. Goats are normally habituated to eat vast variety of tree leaves which usually contain anti-nutritional factors like tannins. Their tannin tolerance is higher than other livestock. This may be due to speciaUzed microbial ecosystem. Present study was aimed to explore the effect of tannins on ruminal microbes using real time PCR approach. Tannins are most effective against the fiber-degrading (cellulolytic) bacteria like Fibrobacter succinogens, Riiminococcus species, Butyrivibrio fibrisolvens, Ruminobacter amylophilus. The ruminants which continuously feed upon diets rich in tannins usually develop a microflora which is tolerant to high tannins such bacteria includes Streptococcus capriniis, Streptococcus bovis, Selenomonas ruminantium, Clostridium species and class proteobacteria. The experiment was conducted on eight adult goats divided into 4 groups viz. Tl: control (0% acacia nilotica pods in TMR, 0% tannin), T2: 25% acacia nilotica pods in TMR (3.5% tannin), T3: 43% acacia nilotica pods in TMR (6% tannin) and T4: 59% acacia nilotica pods in TMR (8.5%) tannin). The Total Mixed rations with different levels of Acacia pods were produced and fed to respective goats ad lib. Rumen liquor (200 ml) was collected on 0, 15th and 30th day of experiment at 0, 3 and 6 hrs post feeding from each animal to study the effect of tannins on bacterial population. The bacterial DNA was extracted from pooled samples of both animals in each group by enzyme-chemical lysis method from rumen fluid. The DNA stock samples were quantified using Nano-drop spectrophotometer at 260 and 280 nm. Purity of DNA was judged on the basis of optical density ratio at 260:280 nm which was between 1.8 to 2.0 for all the samples indicating desirable purity. Species specific primers were used to amplify the bacteria (Selenomonas niminantium, Streptococcus bovis, Fibrobacter succinogenes, Treponema bryantii, Anaerovibrio lipolytica, Total Bacteria, Prevotella ruminicola, Ruminococcus albus, Methanobacteriales and Methanomicrobiales targeting 16S rRNA gene were used for amplification of DNA. The amplified products were visualized as a single compact band of expected size under UV light. The PCR products were purified by eluting the PCR product from the agarose using QIAquick Gel Extraction Kit - Qiagen and were ligated in pTZ57R/T vector of InsT/Aclone TM kit (Fermentas). This was followed by transformation into competent cells (DH5-α strain) of E.coli. Recombinant colonies were picked up by Blue white screening. White colonies were confirmed for presence of insert by colony PCR using M13 primers. Recombinant colonies were inoculated in Luria Broth for 16-18 hrs. Plasmid extraction from overnight culture was carried out by using QIAprep plasmid extraction kit. The plasmids contain species specific amplified DNA fragment so these plasmids were used as standards while running the real time PCR. Their copy number was calculated using optical density and molecular weight of plasmids. The plasmids were serially diluted and standard plot was prepared and according to the plot, the concentration of amplified DNA and ultimately the bacterial population was measured. All samples along with standard plasmids were amplified with species specific primers using real time PCR. The population of bacteria Selenomonas ruminantiwn increased with increase in level of tannins in different group (1314% increase in group IV followed by 747% and 210%) in group III and II respectively at 30th day of experiment) of animals and also with period of experimentation (Increased with 844%) and 1314% at 15th and 30th day respectively in group IV). Similarly the population of Streptococcus bovis also increased with increase in level of tannins and with period of feeding (555%o increase in group IV at 30th day). The lipolytic bacteria Anaerovibryo lipolytica increased with increase in level of tannins in feed (3645% increase in group IV). The results revealed Selenomonas ruminantium and Streptococcus bovis as tannin tolerant bacteria. Tarmins have inhibitory activity against fibrolytic bacteria Fibrobacter succinigenes and reduction in population was more prominent at 30th day of experiment (decreased by 73%, 67%) and 57% in group FV, III and II respectively). Similar inhibitory effect (78% decrease in group IV) was also seen in Treponema bryantii which is saccharolytic spirochete and has been shown to be associated with the fibrolytic bacteria of the rumen. The population of proteolytic bacteria Prevotella niminicola was not affected at any level of tannins throughout the experiment. At low level (3.5%), tannins have beneficial effect on microbial growth for total bacterial population but no effect was seen at other levels. The population of methanogens of the order Methanobacteriales and Methanomicrobiales also remain unchanged even at the highest level of tannins. The population of Ruminococcus albus increased at 15th day with the highest in group FV (496%) followed by group III (416%) and group II (308%). At 30th day the population decreased compared to 15th day but remained at higher level to that of 0 day population. The study revealed that Selenomonas ruminantium, Streptococcus bovis and Anaerovibrio lipolytica are major tannin tolerant bacteria in goats. Tannins exert detrimental effect on fibrolytic bacteria like Fibrobacter succinigenes and Treponema bryantii. However no effect of dietary tannins was observed on Prevotella ruminicola, Methanogenes (Methanobacteriales and Methanomicrobiales) and total bacterial population in goats.
  • Thumbnail Image
    ThesisItemOpen Access
    Diversity and molecular characterization of ruminal bacterial flora of goats
    (AAU, Anand, 2009) Patel, Jayesh M.; Jhala, M. K.
    Rumen harbors diverse types of microbes mainly bacteria followed by protozoa, fungi and yeast. Bacterial population as high as 10 power 10 is found in rumen and has a profound effect on nutritional and physiological processes in the host. Much of the pioneering studies on the rumen microbiota are based on microscopic examination and anaerobic culture techniques. But the polymiorphic nature and the difficulty of cultivating the microbes have hampered effective assessment of ruminal ecology by these methods. Newer molecular approaches are available to identify and characterize the bacteria that are based on detecting highly conserved 16S rRNA gene regions. Molecular characterization of rumen microflora in Indian goat apparently has not been carried out yet. Present study was aimed to determine diversity and molecular characterization of ruminal bacterial flora of goats using 16S r RNA gene amplification, cloning and sequencing of gene followed by phylogenetic analysis. Five goats reared at Instructional farm managed by Livestock production and management department at College of Veterinary Science and AH., Anand, were used for rumen liquor collection using a flexible stomach tube. The bacterial DNA was isolated from strained rumen liquor following enzyme-chemical lysis method The quality and quantity of DNA stock sample was determined using Nano-drop spectrophotometer and agarose gel electrophoresis. Universal primers for bacteria 27F (5'AGAGTTTGATCCTGGCTGGCTCAG 3') and 1492R (5' GGTTACCTTGTTACGACTT 3') targeting 16S rRNA gene were used for amplification of DNA. The amplified product was visualized as a single compact band of expected size (1346 bp) by gel documentation system. PCR product was subsequently eluted from agarose gel and ligated in pDrive vector followed by transformation into competent E. coli (DH5-a strain) cells. White recombinant colonies were selected (n=102), revived on fresh plates and screened for expected insert by colony PCR. Clones showing the amplification of 1346 bp DNA fragment were considered as positive clones (n=73) carrying desired insert of 16S rRNA gene. Screened products of colony PCR were subjected to Restriction Fragment Length Polymorphism (RFLP) analysis by Haelll and clones with common banding pattern were removed (n= 12) and remaining colonies (n=61) were used for plasmid extraction. The concentration of the plasmid was determined and was subjected to automated DNA sequencing on ABI PRISM® 310 Genetic Analyzer (Apphed Biosystems, USA) using BigDye® Terminator v3.1 Cycle sequencing kit. Sequences with good quality value (n=60) were selected for further analysis. Sixty sequences of good integrity were subjected to in silico processing by three ways viz. Similarity search using MEGA BLAST at NCBI nucleotide database, Taxonomic classification by Ribosomal Database Project (RDP) and Phylogenetic analysis. Out of 60 clones, 46 clones (77%) showed similarities in the range of 95-99%, nine clones (15%) in range of 90-94% and five clones (8%) showed less than 90% (of which four clones falling between 85-89%) similarities with NCBI nucleotide database. Five clones (8%) showed similarities with known bacterial species (viz. Ruminococcus albus, Ruminococcus flavefaciens, Prevotella multiformis {2 clones} and Butyrivibrio fibrisolvens), five clones (8%) showed similarities with known bacterial genera (viz., Ruminococcus, Prevotella, sad Bacillus {3 clones}). Taxonomic classification by RDP revealed that 60 clones were mainly distributed into two phyla, namely Bacteroidetes with 21 (35.0%) clones, Firmicutes with 20 (33.0%) clones, 17 (29%) clones fell under unclassified bacteria and two (3%) clones were grouped under unclassified root. Phylogenetic analysis using neighbour-joining method revealed three clones (5%) out of 60 as spp, two clones (3%) as genera, one clone (1.6%) as family and 27 clones (45%) as imcultured/unidentified rumen bacteria. Remaining 27 clones (45%) appeared to be novel, which showed distinct genetic grouping than the other reported sequences in the database. All the sequences were submitted to GenBank and are available with the accession numbers FJ970656 to FJ970715 in EMBL, GenBank and DDBJ Nucleotide Sequence Databases.
  • Thumbnail Image
    ThesisItemOpen Access
    EFFECT OF DIFFERENT CATEGORIES OF SERA AND BOVINE SERUM ALBUMIN ON IN VITRO MATURATION OF SURTI BUFFALO OOCYTES
    (AAU, Anand, 2009) MISTRY, CHIRAG NATAVARLAL; Dhami, A. J.
    This study was conducted over a period of 6 months from September 2008 to February 2009 with the objectives of evaluating the effects of different concentrations (0.05, 0.1, 0.3, 0.6 and 0.9 per cent) of BSA-FAF and also of different categories of sera like Fetal Calf Serum (Gibco), Fetal Buffalo Serum, Oestrus Buffalo Serum, Postoestrus Buffalo Serum and Anestrus Buffalo Serum (all @ 20%) in relation to standard BSA (0.6%) on in vitro maturation of buffalo oocytes in TCM-199 medium. The rate of maturation was confirmed both by cytoplasmic and nuclear maturation using Hoechst stain 33342. A total of 456 ovaries of Surti buffaloes collected from the local slaughter house were transported to the laboratory at 30°C in normal saline solution within I72 hours of slaughter of animal for further processing. In all 1409 oocytes were recovered from them by using slicing method of surface follicles. The sera samples used for culture were obtained from the animals showing different stages of oestrous cycle and were heat inactivated in the laboratory. An average number of follicle of small, medium and large size found per ovary was 0.82, 0.48 and 0.24, respectively, with an overall mean of 1.55. The distribution of these follicles came to 53.18, 31.12-and 15.70 percent, respectively. The slicing method of oocyte recovery gave quite good result. The average oocyte recovery was 3.09 per ovary. The average recovery rate of Grade A, Grade B and Grade C oocyte was 1.02,1.22 and 0.85, respectively. The maturation rate with 0.05, 0.1, 0.3, 0.6 and 0.9 per cent concentration of BSA in TCM-199 was found to be 44.52, 50.99, 59.02, 84.43 and 64.29 per cent, respectively. The BSA 0.6 per cent yielded the highest maturation rate, which differed significantly from other BSA concentrations. The maturation rate for locally prepared FOBS, AnBS, FCS (Gibco), FBS and OBS was found to be 64.63, 54.55, 70.63, 60.48 and 78.16 per cent, respectively. The medium containing oestrus buffalo serum yielded significantly higher (P<0.05) maturation rate than the others, though it was little less than the BSA 0.6. The highest maturation of Grade A oocytes was found in BSA 0.6 followed by OBS and other sera. While in Grade B it was in BSA 0.9 followed by BSA 0.6, and for Grade C oocytes the highest maturation rate was with BSA 0.6 followed by FOBS. According to nuclear maturation, the highest number of oocytes with germinal vesicle was found in medium containing FBS (25.21 %) followed by AnBS and others. The highest number of germinal vesicle break down was found in FOBS (30.61 %) followed by FCS (Gibco) and others. The higher number of oocytes with Metaphase-I was in the medium containing BSA 0.6 per cent (22.13 %) followed by FCS (Gibco), while, the Metaphase-II stage was found to be higher in medium containing OBS (41.38 %) followed by BSA 0.6 and others. Degenerated oocytes were maximum with BSA 0.05 per cent (40.41 %) and minimum with OBS (9.20 %). It was concluded that BSA concentration of 0.6 per cent is the optimum for in vitro maturation of buffalo oocytes, and that OBS can be used instead of BSA as a cheaper and easily available source of serum for in vitro maturation of buffalo oocytes.
  • Thumbnail Image
    ThesisItemOpen Access
    DETECTION OF POLYMORPHISM IN BOVINE PREIMPLANTATION ACTIVE GENES AND THEIR ASSOCIATION WITH SEMEN QUALITY
    (AAU, Anand, 2008) AHIR, VIRAL B.; Panchal, M. T.
    Embryo development in mammals is marked by distinctive biological processes that occur during the preimplantation and early post implantation periods. Preimplantation development encompasses the period from fertilization to implantation, which occurs in different times in various species and it is marked by a number of critical events. This development is a mammalian-specific event, and is vital for successful implantation and pregnancy. Bovine preimplantation embryo development is under constant control of genes activated from either maternal or embryonic genome. Large-scale association studies by genotyping many single nucleotide polymorphisms (SNPs), in individuals with well characterized phenotypes, are considered as promising methods to identify the cause of many complex traits. The present study was undertaken to study the polymorphism of bovine preimplantation active genes loci by PCR-RFLP and PCR-SSCP techniques and their association with various semen quality traits in Murrah buffalo bulls belonging to ARDA, Ode during January to June 2008. The mean and standard error of mean (SEM) for various semen quality parameters, viz., volume (ml), concentration (106/ml), motility (%), motility after thawing(%) and live and dead count (%) was found to be 3.35+0.27, 1511.07+112.25, 73.54+1.05, 54.39+0.66 and 85.44+0.47, respectively. Semen DNA was extracted from 41 Murrah buffalo bulls by Proteinase K method as per standard protocol. Bovine COX-2, CD9, DSC2, AKRIBI and CDHl genes specific primers (COX-2 F: 5'-TGA TCT ACC CGC CTC ATG TT-3' and COX-2 R: 5'-CCC TTT GCC TGG TGA ATG-3'); (CD9 F: 5'-GAG GCA AAA CTC CAA AAC CA-3' and CD9 R: 5'-CTC CAC TGT CGT TTG TCG TG -3'); (DSC2 F: 5'-AAA GTG CAA GAC ATG GAT GG-3' and DSC2 R: 5'-CCT TCA TTG GTT TGG GAA TC-3'); (AKRIBI F: 5'-ACC AGG GCT TAC CTG GAA GT-3' and AKRIBI R: 5'-GGT CAA TGG GCC TTA GGA TT-3') and (CDHl F: 5'-CGC ACA ACA AAA TGT TCA CC-3' and CDHl R: 5'-GGC CTC AAA TCT CCA GAC AA-3') were used to amplify bovine preimplantation active genes loci. PCR was carried out in 25 µl volume for 35 cycles of denaturation at 94°C, annealing at appropriate temperature (COX-2 locus at 52°C, DSC2 and CDHl loci at 51°C, AKRIBI locus at 58°C) and extension at 72°C. Initial denaturation was carried out at 94°C for 5 minutes, while the final extension was performed at 72°C for 5 minutes. For the CD9 locus "Touch down PCR" was performed to avoid spurious priming during PCR amplification. Amplified products were electrophoresed on 2% Agarose gel at 80 V for for 60 minute. For RFLP analysis Amplified PCR product of COX-2, CD9, DSC2 and AKRIBI loci were digested with Alu I, Dra I, Rsa I and Nde /restriction enzymes respectively, by incubating them at 3 7°C for 14-16 hours except for Rsa I which was incubated at 37°C for 12 minute and electrophoresed on 2% Agarose gel at 80 V for 60-90 minutes to reveal the restriction pattern. Monomorphic pattern was observed for the COX-2, CD9 and DSC2 loci and only TT, TT and AA genotypes, respectively, were found in all Murrah buffalo bulls at these loci. The allelic frequencies of T, T and A alleles were 1.00, with absence of A, A, and G alleles, respectively. For AKRIBI locus, 18 samples were found to be homozygous AA and 23 samples were heterozygous AG, with allelic frequency of 0.725 and 0.275 for A and G alleles, respectively. For SSCP analysis, PCR products of CDHl locus were denatured and electrophoresed on 6% non-denaturing PAGE for 4-5 hours at constant 5W. Analysis revealed four different banding patterns with frequencies for pattern 1, pattern 2, pattern 3 and pattern 4 to be 0.463, 0.146, 0.292 and 0.097, respectively. Since, loci COX-2, CD9 and DSC2 were found to be monomorphic, h was not possible to correlate them with the semen quality traits. Loci AKRIBI and CDHl were found to be polymorphic but, statistical analysis revealed no significant association (P>0.05) of this loci with any semen quality parameters.
  • Thumbnail Image
    ThesisItemOpen Access
    ISOLATION OF PPR VIRUS, DETECTION BY ELISA AND DIFFERENT GENE BASED RT-PCR
    (AAU, Anand, 2008) CHOUDHARY, POOJA; Jhala, M. K.
    Peste des petits ruminants (PPR) is a severe viral disease of goats and sheep with high morbidity and sometimes high mortality characterized by fever, erosive stomatitis, conjunctivitis, gastroenteritis and pneumonia. PPR is caused by Peste des petits ruminants virus (PPRY), a Paramyxovirus of the Morbillivirus genus. The disease causes severe economic losses to small ruminant husbandry and is presently considered as one of the major threats to about 200 million small ruminant population of the country. The present study was aimed to detect PPRV in clinical samples using s-ELISA and to derive estimates of overall, locationwise and specieswise incidence of PPRV. The study also involved the isolation of PPR virus from clinical samples and assessment of F, N and H gene targets for detection of PPRV by RT-PCR from the clinical and cell culture samples. A total of 98 clinical samples comprising of 48 tissues, 12 blood and 38 serum samples from 79 animals including 26 sheep and 53 goats suspected of PPRV infection, were collected from three different districts of Gujarat (Rajkot, Bhavnagar and Gandhinagar) and tested for PPRV antigen by s-ELISA (PPR s-ELISA kit, developed by Division of Virology, IVRI, Mukteshwar), of which 75 animals were found positive yielding an overall incidence rate of 94.90 per cent. Out of 10 animals (goat) suspected of PPR, six were positive (60%) by s-ELISA in Rajkot district. All the 32 and 37 animals (sheep and goats) showing clinical signs suggestive of PPR from Bhavnagar and Gandhinagar districts were found positive by s-ELISA yielding 100 %'incidence at both these locations. Sheep was found to be more susceptible to infection yielding a positivity rate of 100 per cent than goats (92.4%). The PPR antigen could be detected marginally more in tissue samples (95.83%) than in blood (83.33%) and serum samples (89.47%) by s-ELISA. A total of 23 samples including 15 cell culture samples, six tissue samples, one whole blood and reference vaccine virus (Sungri isolate) were processed for RNA extraction using TRI Reagent®. RNA samples showing acceptable purity and concentration were reverse transcribed with random hexamers to generate cDNA templates, which were subjected to PCR amplification using F, N and H gene based primers. Reference vaccine virus as well as 10, 11 and 8 out of 15 cell culture samples of the three isolates produced approximately 372 bp amplicon with F1 / F2, 351 bp amplicon with NP3 / NP4 and 713 bp amplicon with H1 / H2 primers respectively. A total of 23 samples were tested by both s-ELISA and RT-PCR, including reference vaccine virus, seven field samples (six tissues, one whole blood) and 15 cell culture samples. Out of the total samples tested, PPRV could be detected in reference vaccine virus and 19 samples by s-ELISA and 15, 18 and 11 samples including reference vaccine virus by F, N and H gene based RT-PCR respectively. None of the sample positive in RT-PCR was negative by s-ELISA. Relative to s-ELISA, sensitivity of the RT-PCR for F, N and H gene was 78.94, 94.70 and 57.89 respectively and specificity for all the three was 100 per cent. Three representative samples comprising of one pooled tissue sample, one whole blood sample and one serum sample were inoculated in Vero cells for five viral passages to isolate the field PPR virus. All the three samples inoculated showed similar CPE. During first passage, changes associated with rounding of cells and isolated initiation foci were observed. During second and third passages, CPE characterized by ballooning of cells and later aggregation of cells followed by formation of fusion mass and syncytia were recorded. Cell lysis was also observed in few cases. During fourth and fifth passages, the above mentioned CPE increased in intensity with more number of cells showing fusion mass and detachment. The monolayer infected with sterile PBS (negative control) did not show such changes. The isolation of PPRV in cell culture was confirmed by s-ELISA after second passage for all the three samples and after P3, P2 and P2 passage by F, N and H gene based RT-PCR.
  • Thumbnail Image
    ThesisItemOpen Access
    Identification of Polymorphism in Bovine CYP1A1 gene segment by SSCP and DNA Sequencing
    (AAU, Anand, 2009) PARIKH, RAKESH KUMAR CHATURBHAI; Bhavsar, S. K.
    The most important drug metabolizing enzyme family, Cytochrome P450 (CYP) is one of the conserved entities among species. The cytochrome P450 enzyme system is responsible for the metabolism and clearance of a wide array of drugs, toxins and endogenous substrates. The family is involved in metabolism of 70 - 80% of drugs, nutrients, endogenous substances and environmental toxins. Studies concerning Cytochrome P450 polymorphism, expression and regulation have received very little attention in veterinary species (e.g. cattle, swine, poultry), compared to man and laboratory animals. These species are often exposed to drugs, pesticides or pollutants potentially harmful not only for the animal itself, but also for humans as a consequence of the accumulation of residues in animal edible tissues. Genetic heterogeneity has been increasingly recognized as a significant source of variation in drug response. This variation is largely due to inherited differences that can influence the pharmacokinetics and hence pharmacology of drug substrates. The effects can be profound toxicity or reduced efficacy of drugs metabolized by such polymorphic enzymes. Blood samples of Kankrej and Gir breeds of cattle were obtained from Livestock Research Station, Veterinary College, Sardar Krushinagar Dantiwada Agricultural University, Sardar Krushinagar, District - Banaskantha and BAPS Swaminarayan Mandir, Sarangpur District - Ahmedabad, respectively. One hundred blood samples (50 each of Kankrej and Gir breeds) of cows were collected. DNA extraction was carried out by Nonidet P40 and phenol: chloroform method from blood samples of cows. Primers were designed from reported sequences of CYPlAl gene in NCBI by primer 3 software. Primer pair viz., 5'GCCTGAAGAGTCCACCAGAG 3' andR- 5'GTCTGGGTTGAAGGTCATGC 3' targeting CYPlAl gene was used for amplification of DNA. The amplified product was visualized as a single compact band of expected size under UV light and revealed amplicons of 272 bp size when documented by gel documentation system. CYPlAl gene segment PCR products were subjected to PCR-SSCP analysis Two SSCP band patterns were observed. Frequency of pattern 1 in population was 0.42 while that of pattern 2 was 0.58. Representative sample PCR products from variant SSCP pattern of CYPlAl were purified and cloned in pTZ57R/T vector of hisT/Aclone TM kit. Ligated recombinant vector was transformed in competent E. coli (DH5-a) cells. Recombinant plasmids were isolated and used for cycle sequencing. Bos indicus (Kankrej) CYPlAl sequence completely matched with reported Bos taurus CYPlAl (AY265991.1) sequence. No mutation was found in Bos indicus (Kankrej) CYPlAl. Whereas Bos indicus (Gir) CYPlAl sequence was matched with reference sequence Bos taurus CYPlAl sequence (AY265991.1) except first and second nucleotide position. Where g > T base change at first nucleotide position and c>T base change at second nucleotide position was detected. Bos indicus (Kankrej) CYPlAl sequence matched with reported Bos taurus CYPlAl (AB060696.1) except nucleotide positions at 46, 49, 67, 73, 87, 103, 214, 269, 275, 277 and showed c>A, g>A, c>T, O T , t>C, a>G, g>C, a > G , a> G, c > T nucleotide changes respectively. Whereas Bos indicus (Gir) CYPlAl mismatched at nucleotide position 33, 34, 46, 49, 67, 73, 87, 103, 214, 269, 275, 277 and showed g > T, C >T, c> A, g >A, c>T, c>T, t>C, a>G, g>C, a > G a > G , c > T nucleotide changes respectively. Bos indicus CYPlAl translated nucleotide sequence showed significant similarity with region of amino acid sequence (amino acid position 1-90) of Bos taurus CYPlAl protein (gb|AAP31898.1|). Different polymorphisms reported in Bos indicus CYPlAl gene segment needs to be correlated with phenotypic (Pharmacokinetic) traits to find out functional effects of all these polymorphism.
  • Thumbnail Image
    ThesisItemOpen Access
    MOLECULAR CHARACTERIZATION AND DIVERSITY OF RUMEN PROTOZOA IN BUFFALO
    (AAU, Anand, 2008) NISHA; Pandya, P. R.
    Rumen harbors diverse types of microbes mainly bacteria followed by protozoa, fungi and yeast. Bacterial population is as high as 10 to power 10 and protozoa population is 10 to power 5 to 10 to power 6 per ml of fluid, found in the rumen and has a profound effect on nutritional and physiological processes in the host. The ability and characteristic of rumen microbes differs. Some are good at digesting concentrate while others at roughage. The study of rumen ecology involves their relationship with each other and the host. Much of the pioneering studies on the rumen microbiota are based on microscopic examination and anaerobic culture techniques. But the polymorphic nature and the difficulty of cultivating the microbes have hampered effective assessment of ruminal ecology by these methods. Newer molecular approaches are available to identify and characterize the eukaryotes and prokaryotes that are based on detecting highly conserved gene regions-16S rRNA and 18S rRNA, respectively for bacteria and protozoa. India possesses more than 50 per cent of world buffalo population. The present study was aimed to determine genetic characterization of rumen protozoa in buffalo and their phylogenetic classification, based on sequence comparison of 18S rRNA gene of rumen protozoa. Three adult buffaloes were maintained on standard dietary regimen as per ICAR (1998) feeding standards, composed of green and dry roughage and compound concentrate mixture, continuously for three weeks. Samples of Rumen liquor (about 500 ml) were collected from three buffaloes at 2, 4 and 6 hrs. after feeding by a suction pump using a flexible stomach tube. Samples were filtered through four layers of cheesecloth. The strained rumen liquor was used for the study. The protozoal DNA was isolated following enzyme-chemical lysis method. The DNA stock samples were quantified using Nano-drop spectrophotometer at 260 and 280 nm using the convention that one absorbance unit at 260 nm wavelength equals 50 µg DNA per ml. The Ultra violet absorbance was checked at 260 and 280 nm for determination of DNA concentration and purity. Quality and purity of DNA were also checked by agarose gel electrophoresis. Protozoa specific primers viz. Euk-82F 5' AAA CTG CGA ATG OCT C -3' and Medlin Be 5' TGA TCC TTC TGC AGG TTC ACC TAG -3' targeting 18S rRNA gene were used for amplification of DNA. The amplified product was visualized as a single compact band of expected size under UV light and revealed amplicons of 1346 bp size when documented by gel documentation system. The PCR products after purification were ligated in pDrive vector followed by transformation into competent cells (DH5-a strain) of E.coli. One hundred fifty white recombinant colonies were obtained out of which 124 were randomly selected, revived on another plates and screened for expected insert by colony PCR. Recombinant colonies were inoculated in Luria Broth for 16-18 hrs. Plasmid extraction from overnight culture was carried out by alkaline lysis method. The concentration of the plasmid DNA was determined and was subjected to automated DNA sequencing on ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, USA). Sequencing was carried out using BigDye® Terminator v3.1 Cycle sequencing kit. Sequences obtained were in the range of 250 to 850 base pairs. Sequences after cleaning (removal of primer and vector sequence) were searched against BLASTn database to find similarity matches. Analysis of the 18S rRNA sequences of protozoal species from ruminal fluid revealed predominance of family Isotrichidae {Dasytricha and Isotricha) and Ophryoscolecidae. Phylogenetic analysis was performed using DNADIST and DNAPARS (Parsimony method) program of PHYLIP package (Felsenstein, 1989). Phylogenetic tree was constructed by neighbor-joining method (Saito and Nei, 1987). Out of 124 clones, 21.7% showed similarity with Ophryoscolex spp., 7.2% showed similarity with Cycloposthium spp., 18.5% with Trichostomatidae, 1.6% with Haptorians and about 51% clones remained as unclassified protozoa which are supposed to be new. In DNADIST analysis, two clones (1.6%) from 124 sequenced clones fall in Haptorian group. The AVCRPN62 clone showed 99% similarity with the Enchelyodon spp. while AVCRPN86 showed 99 % similarity with Arcuospathidium spp. In DNAPARS analysis, AVCRPN62 clone showed 95% similarity with Arcuospathidium spp. and was clustered separately in subcluster II of Cluster III. Twenty seven clones (21.7%) clustered separately with Ophryoscolex spp. (21 clones) and Spathidium spp. (6 clones). Members of this group showed 82% similarity in DNADIST analysis. No clones showed similarity with this group in DNAPARS analysis. Nine clones (7.2%) were showing 94% similarity with Cycloposthium spp. which belonged to Cycloposthiidae family and were grouped in Cluster IV in DNADIST analysis, while 24 clones were showing similarity with Cycloposthium spp. and were grouped in subcluster 1 in Cluster III in DNAPARS analysis. Twenty three clones (18.5%) out of 124 clones were showing similarity with Trichostomatidae and were grouped separately in Cluster V in DNADIST analysis, while 36 clones were showing similarity with Trichostomatidae and were grouped in subcluster IV of Cluster III in DNAPARS analysis. Members of Cluster V showed 77% similarity in DNADIST analysis. This cluster was again divided in four sub clusters:Australian clade, Entodiniomorphs, Dasytricha spp., Isotricha spp. Sixty three clones (51%) clustered separately which were showing no significant similarity with cultured as well as uncultured representatives. Clones in this group can be considered as novel clones. Taxonomic classification of these clones showed that the maximum no of clones show similarity to Isotricha spp., Dasytricha spp. and uncuhured rumen protozoa. All the sequences were submitted to Genbank and are available with the accession numbers EU796091- EU796211 in EMBL, GenBank and DDBJ Nucleotide Sequence Databases.
  • Thumbnail Image
    ThesisItemOpen Access
    EXPRESSION STUDIES OF DIFFERENTIALLY EXPRESSED GENES DURING LACTATION IN INDIAN BUFFALO BY REAL TIME PCR
    (AAU, Anand, 2009) VAZE, MAKARAND NARSINHA; JOSHI, C. G.
    With the growing human population of world, there is always demand of food. It is expected that in future demand of food required is going to exceed the supply available. The supply of adequate and nutritious food will going to be very difficult if the population size remains to increase at same pace. Hence, there is always a need to produce good quality food at lowest possible cost and highest possible production. The present study was undertaken with an objective of determining level of expression of some of the ESTs generated after the exogenous administration of recombinant bovine somatotropin (rbST). Real Time Relative Quantification experiment was done to elucidate level of expression of genes in 0 (without treatment of rbST), 48 and 96 (48 and 96 hours after rbST administration) mammary tissue samples collected from Surti buffalo. RNA extraction was done using TRJ- reagent protocol. First strand cDNA synthesis was done using oligodT primer. Real Time PCR was done using gene specific forward and reverse primers designed from available ESTs sequences and SYBR Green Master Mix. Level of expression was deduced using Sequence Detection Software v 1.3.1 (Applied Biosystems). This study showed 13 out of 15 ESTs showing up regulation, 1 was showing down regulation and 1 showing surge in level of expression at 48 hr stage and showed decrease in level of expression at 96 hour stage though it was higher than 0 hr.
  • Thumbnail Image
    ThesisItemOpen Access
    PARENTAGE VERIFICATION IN FIELD PROGENY TESTING PROGRAMME OF MEHSANA BUFFALO BY MICROSATELLITE ANALYSIS
    (AAU, Anand, 2008) JAKHESARA, SUBHASH J.; Solanki, J. V.
    The knowledge of correct parentage is a prerequisite in breeding programmes. The identification of proven sires has been of utmost importance in animal improvement programmes. Failure to record correct parentage can cause bias in sire evaluation, by introducing errors in estimates of heritabilities and breeding values. Microsatellites are preferred molecular markers for individual identification and parentage verification. Present study aimed at verifying parentage in daughters covered under progeny testing program operated by Dudhsagar Research and Development Association (DURDA), Mehsana. A total number of 212 Mehsana buffalo samples including 100 daughters for parentage testing, 12 sires and 100 dams were genotyped. Multiplex primer panel containing set of eleven fluorescent labeled microsatellite markers (CSSM61, ILSTS29, ILSTS17, ILSTS28, CSSM43, CSSM57, CSSM22, ILSTS61, CSSM8, ETH152, ILSTSl 1) was developed after screening of 22 microsatellites selected fi-om available list of 25 microsatellites suggested by the National Bureau of Animal Genetic Resources (NBAGR) and 25 cattle specific microsatellites. Primers were selected after their successful amplification individually and in multiplex panel. Multiplex panel was designed in a way that amplification of any primer does not overiap with amplification of other primer with the same dye. Multiplex panel was standardized and optimized for primer concentration and annealing temperature. Eleven microsatellites were amplified in single multiplex for automated fluorescence genotyping to verify parentage in Mehsana buffalo breeds. The number of alleles varied from 5 for marker ILSTSll to 16 for marker ILSTS61. The heterozygosity of the 11 different markers ranged between 0.281 for marker CSSM43 and 0.821 for marker ILSTS61. Calculated PIC values ranged from 0.80 highest for marker CSSM61 to 0.60 lowest for marker ILSTS29. Mean number of alleles per locus (k) was 9.91, Mean observed heterozygosity (HObs) was 0.675, Mean expected heterozygosity (HExp) was 0.762, Mean PIC observed was 0.730. Exclusion probability was highest for marker ILSTS61 and CSSM 61(0.49) and lowest for marker ILSTS29 and CSSM57 (0.25). The combined exclusion probability of all 10 markers was 0.993. Combined exclusion probability using five most polymorphic markers was 95.5 % and for all ten markers was 99.3 %. Paternity of 19 of 100 daughters (19%) was excluded because putative paternal alleles were not present in the progeny for at least two locus. Parentage was assigned to 95 daughters with strict confidence using Cervus 3.0 and five daughters were declared unassigned. Parentage verification also performed manually to check the results obtained by Cervus and they were in accordance. The developed panel of 10 microsatellites in a single multiplex constituted a fast, robust, reliable and economic tool to verify the parentage and assign the putative sire to daughters under progeny testing with very high accuracy. This can be used in routine parentage testing.