Identification of Polymorphism in Bovine CYP1A1 gene segment by SSCP and DNA Sequencing
Loading...
Date
2009
Authors
Journal Title
Journal ISSN
Volume Title
Publisher
AAU, Anand
Abstract
The most important drug metabolizing enzyme family, Cytochrome P450 (CYP) is one of the conserved entities among species. The cytochrome P450 enzyme system is responsible for the metabolism and clearance of a wide array of drugs, toxins and endogenous substrates. The family is involved in metabolism of 70 - 80% of drugs, nutrients, endogenous substances and environmental toxins. Studies concerning Cytochrome P450 polymorphism, expression and regulation have received very little attention in veterinary species (e.g. cattle, swine, poultry), compared to man and laboratory animals. These species are often exposed to drugs, pesticides or pollutants potentially harmful not only for the animal itself, but also for humans as a consequence of the accumulation of residues in animal edible tissues. Genetic heterogeneity has been increasingly recognized as a significant source of variation in drug response. This variation is largely due to inherited differences that can influence the pharmacokinetics and hence pharmacology of drug substrates. The effects can be profound toxicity or reduced efficacy of drugs metabolized by such polymorphic enzymes. Blood samples of Kankrej and Gir breeds of cattle were obtained from Livestock Research Station, Veterinary College, Sardar Krushinagar Dantiwada Agricultural University, Sardar Krushinagar, District - Banaskantha and BAPS Swaminarayan Mandir, Sarangpur District - Ahmedabad, respectively. One hundred blood samples (50 each of Kankrej and Gir breeds) of cows were collected. DNA extraction was carried out by Nonidet P40 and phenol: chloroform method from blood samples of cows. Primers were designed from reported sequences of CYPlAl gene in NCBI by primer 3 software. Primer pair viz., 5'GCCTGAAGAGTCCACCAGAG 3' andR- 5'GTCTGGGTTGAAGGTCATGC 3' targeting CYPlAl gene was used for amplification of DNA. The amplified product was visualized as a single compact band of expected size under UV light and revealed amplicons of 272 bp size when documented by gel documentation system. CYPlAl gene segment PCR products were subjected to PCR-SSCP analysis Two SSCP band patterns were observed. Frequency of pattern 1 in population was 0.42 while that of pattern 2 was 0.58. Representative sample PCR products from variant SSCP pattern of CYPlAl were purified and cloned in pTZ57R/T vector of hisT/Aclone TM kit. Ligated recombinant vector was transformed in competent E. coli (DH5-a) cells. Recombinant plasmids were isolated and used for cycle sequencing. Bos indicus (Kankrej) CYPlAl sequence completely matched with reported Bos taurus CYPlAl (AY265991.1) sequence. No mutation was found in Bos indicus (Kankrej) CYPlAl. Whereas Bos indicus (Gir) CYPlAl sequence was matched with reference sequence Bos taurus CYPlAl sequence (AY265991.1) except first and second nucleotide position. Where g > T base change at first nucleotide position and c>T base change at second nucleotide position was detected. Bos indicus (Kankrej) CYPlAl sequence matched with reported Bos taurus CYPlAl (AB060696.1) except nucleotide positions at 46, 49, 67, 73, 87, 103, 214, 269, 275, 277 and showed c>A, g>A, c>T, O T , t>C, a>G, g>C, a > G , a> G, c > T nucleotide changes respectively. Whereas Bos indicus (Gir) CYPlAl mismatched at nucleotide position 33, 34, 46, 49, 67, 73, 87, 103, 214, 269, 275, 277 and showed g > T, C >T, c> A, g >A, c>T, c>T, t>C, a>G, g>C, a > G a > G , c > T nucleotide changes respectively. Bos indicus CYPlAl translated nucleotide sequence showed significant similarity with region of amino acid sequence (amino acid position 1-90) of Bos taurus CYPlAl protein (gb|AAP31898.1|). Different polymorphisms reported in Bos indicus CYPlAl gene segment needs to be correlated with phenotypic (Pharmacokinetic) traits to find out functional effects of all these polymorphism.
Description
Keywords
ANIMAL BIOTECHNOLOGY, A STUDY