Thumbnail Image

University of Agricultural Sciences, Bengaluru

University of Agricultural Sciences Bangalore, a premier institution of agricultural education and research in the country, began as a small agricultural research farm in 1899 on 30 acres of land donated by Her Excellency Maharani Kempa Nanjammanni Vani Vilasa Sannidhiyavaru, the Regent of Mysore and appointed Dr. Lehmann, German Scientist to initiate research on soil crop response with a Laboratory in the Directorate of Agriculture. Later under the initiative of the Dewan of Mysore Sir M. Vishweshwaraiah, the Mysore Agriculture Residential School was established in 1913 at Hebbal which offered Licentiate in Agriculture and later offered a diploma programme in agriculture during 1920. The School was upgraded to Agriculture Collegein 1946 which offered four year degree programs in Agriculture. The Government of Mysore headed by Sri. S. Nijalingappa, the then Chief Minister, established the University of Agricultural Sciences on the pattern of Land Grant College system of USA and the University of Agricultural Sciences Act No. 22 was passed in Legislative Assembly in 1963. Dr. Zakir Hussain, the Vice President of India inaugurated the University on 21st August 1964.

Browse

20083
Reset filters
Subject: Fruit Science × End date: 2009 × Start date: 2008 ×
Reset filters

Search Results

Now showing 1 - 3 of 3
  • Thumbnail Image
    ThesisItemOpen Access
    STUDIES ON SEED VIABILITY, GERMINATION AND SEEDLING GROWTH OF MINOR FRUIT PLANTS
    (University of Agricultural Sciences GKVK, Bangalore, 2008-08-18) SMITHA, M. N.; NACHEGOWDA, V.
    The studies on seed viability, germination and seedling growth of seven minor fruit plants (Tamarind, Jack fruit, Syzygium cuminii, Syzygium jambos, Aonla, Annona and Wood apple) was studied at the Horticulture Research station, department of Horticulture, University of Agricultural Sciences, GKVK Bangalore during the year of 2006-07. Tamarind seed germination was highest when fresh seeds were sown (93%) and seedling height , number of leaves , stem girth ,root length were maximum at 90 days stored seeds. The vigour index of seedlings was found to be highest in fresh seeds. The seed germination in Jack was highest in fresh seeds (100%), the seedling height, number of leaves, stem girth, root length and vigour index was maximum in fresh seeds. The seed germination in Syzygium cumini was highest (100%) in fresh seeds, the seedling height, number of the leaves and root length was highest in 120 days stored seeds. The vigour index was found to be more in fresh seeds. The Syzyguim jambos the seed germination was highest in fresh seeds. The seedling height, number of the leaves, girth, root length, root girth, fresh and dry weight, vigour index were also varied with the storage period of seeds. Aonla seed germination was maximum (87 %) in fresh sown seeds. The seedling height, number of leaves, stem girth, root length, root girth, fresh and dry weight were varied with the storage period of seeds. Annona seed germination (67%) was highest in fresh seeds. The seedling height, number of the leaves, girth, root growth, root length, fresh and dry weight varied with the storage period of the seeds. The seed germination, seedling height, number of leaves, stem girth, root length, root girth, fresh and dry weight and vigour index in wood apple was also found to be highest in fresh seeds.
  • Thumbnail Image
    ThesisItemOpen Access
    EVALUATION OF CRACKING AND NON - CRACKING GENOTYPES OF JACK AND IDENTIFICATION OF SCAR MARKER RELATED TO FRUIT CRACKING
    (University of Agricultural Sciences GKVK, Bangalore, 2008-07-29) ROMEN SINGH, S.; NARAYANASWAMY, P.
    The investigations on “Evaluation of cracking and non-cracking genotypes of Jack and identification of SCAR marker related to fruit cracking” were carried out at the Plant Molecular Biology Laboratory, Division of Horticulture, UAS, GKVK, Bangalore-65, during the period 2007-2008. A survey was conducted in the orchards of Department of Horticulture, Farm Superintendent Office of UAS, Bangalore and State Department Farm, Tamaka at Kolar District. Study employed morphological and molecular markers for differentiating cracking and non-cracking type. Of all the cultivars used in the survey, the cultivar T-10 was the tallest. TCJ-03 produce highest number of fruits (58). The other parameters like stem thickness (120cm) and number of branches (20) were also highest in TCJ-03. The quality parameters in term of TSS was higher, acidity was low (0.04%) with moderate pectin (2.89%) in the cultivar TCJ-04 as compare to other. The RAPD analysis identified OPC-07 as the polymorphic primer showing band size of 810 bp as the polymorphic marker. The sequence data of fruit cracking character was analysed for its identity using BLASTX search for its homology with the sequence of a gene already recorded in the database of the NCBI, Bethesda, USA. Nucleotide sequence data reported here have been deposited in Gene Bank (NCBI) under the accession numbers – dbEST-ld User-ld GeneBank-Accn 56934622 Jackfruit 1 FG 228207 The sequence of the marker associated with fruit cracking as follows GTCCCGACGAGCAAAAGCTGGATTGGCAAAAAACTTGAGTTGCATATTACCGCGTTGGG TAAGGCATTATTAGCCTGGAAGACACGAGATGAACTGGATTATTTTTTAGAAGCACTCA CGTTAACTCCTCATACGCGCAATACATTTACCGATAAAAAATTGTTTCTGGAAGAATTAC AAAAAACACGCCTTCGGGGATGGGCCATAGACAACGAAGAATCAACCTATGGGGCGGT ATGTTTAAGTATGCCGGTATTCAATATGTATAGCAGAGTTAACTATGCAATCTCGCTTTC TGGCGATCCGGTAGTTTATTCAGGAAATAAGATAGACAGCTATCTGGAATTGCTCCGGA AATGCGCTGAGCAAATATCATATGGGCTGGGATACAGAAACGAAAATGAGCACTTACG AAAAGGAAACTGAGGTAATGAAAAAATTCAGCGGCATTATTCCACCGGTATCCAGCACG TTTCATCGTGACGGAACCCTTGATAAAAAGCAATGCGCGAAGTTGCCGACTTCCTGATTA ATAAAGGGGTCGACGGGCTGTTTTATCTGGGTACCGGTGGTGAATTTAGCCAAATGAAT ACAGCCCAGCGCATGGCACTCGCCGAAGAAGCTGTAACCATTGTCGACGGGCGAGTGCC CGGTATTGATTTGGCGTCGGTTCCCCTTCCACTGACGAAGCGGTCAAACTGGCGCAGCAT GCGCAAGCCTACGGCGCTGATGGTATCGTCGGGAC In the present study, these findings illustrated the usefulness of molecular markers as a tool for the crop improvement programs in jackfruit by identifying the marker associated with fruit cracking which can be used for identification of cracking types in the seedling stage itself.
  • Thumbnail Image
    ThesisItemOpen Access
    EFFECT OF TURFVIGOUR AND AGRIPLEX ON STRAWBERRY [Fragaria x ananassa Duch.] cv. ‘SUJATHA’
    (University of Agricultural Sciences GKVK, Bangalore, 2008-07-29) MOHAMMAD GULAB, OMARI.; Nachegowda, V.
    A study was undertaken during 2007-2008 at the Horticultural Research Station, University of Agricultural Sciences, GKVK, Bangalore to assess the effect of foliar application of TurfVigour and Agriplex at different concentrations on growth, yield, quality and nutrient uptake of strawberry cv. Sujatha. Foliar application of [TurfVigour 10 lit/ha + Agriplex 3.25 lit/ha] at 15 days interval along with recommended dose of fertilizers [40: 100: 150 kg NPK/ac] and organic manure [FYM 25 tonnes + neem cake 500 kg/ac] resulted in maximum plant growth viz., plant height [28.64 cm], plant spread [2184.99 cm2], number of leaves [159.05], index leaf area [40.16 cm2], number of runners per plant [25.94], leaf total chlorophyll [2.42 mg/g] chlorophyll ‘a’ [1.69 mg/g] and chlorophyll ‘b’ [0.73 mg/g] contents, maximum yield attributes viz., early flowering [120.50 days], full flowering [133.00 days], number of flower per plant [25.49] fruit set percentage [85.28%] number of fruits per plant [21.89], number of fruits per bed [414.13], fruit yield per plant [146.75g], fruit yield per bed [3.94 kg], fruit yield per hectare [8.47 t/ha], highest number of large sized A grade fruits [43.80] and fruit character viz., fruit weight [10.80 g], fruit volume [14.92 ml], polar diameter of fruit [4.97 cm], transverse diameter of fruit [3.67 cm], were highest. The quality parameter viz., TSS [8.76 0Brix], total sugars [8.200%], reducing sugars [ 2.367%], non – reducing sugars [5.937%] were maximum and titratable acidity [0.700%] was lowest leaf nutrient content viz., nitrogen [2.95%], phosphorous [0.57%], potassium [2.97%], calcium [4.25%] and micro nutrients such as iron [167.95 ppm], manganese [183.25 ppm], zinc [95.75 ppm], copper [45.75 ppm], were recorded maximum in the above mentioned treatment. Foliar spray of TurfVigour 10 lit/ha and Agriplex 3.25 lit/ha at 15 days interval can be adopted in commercial cultivation of strawberry.