Loading...
Anand Agricultural University, Anand
Anand Agricultural University (AAU) was established in 2004 at Anand with the support of the Government of Gujarat, Act No.(Guj 5 of 2004) dated April 29, 2004. Caved out of the erstwhile Gujarat Agricultural University (GAU), the dream institution of Sardar Vallabhbhai Patel and Dr. K. M. Munshi, the AAU was set up to provide support to the farming community in three facets namely education, research and extension activities in Agriculture, Horticulture Engineering, product Processing and Home Science. At present there seven Colleges, seventeen Research Centers and six Extension Education Institute working in nine districts of Gujarat namely Ahmedabad, Anand, Dahod, Kheda, Panchmahal, Vadodara, Mahisagar, Botad and Chhotaudepur
AAU's activities have expanded to span newer commodity sectors such as soil health card, bio-diesel, medicinal plants apart from the mandatory ones like rice, maize, tobacco, vegetable crops, fruit crops, forage crops, animal breeding, nutrition and dairy products etc. the core of AAU's operating philosophy however, continues to create the partnership between the rural people and committed academic as the basic for sustainable rural development. In pursuing its various programmes AAU's overall mission is to promote sustainable growth and economic independence in rural society. AAU aims to do this through education, research and extension education. Thus, AAU works towards the empowerment of the farmers.
Browse
Search Results
ThesisItem Open Access Application of Real Time PCR assay for quantifying bacterial density in the rumen of Goats fed tannin rich diets(AAU, Anand, 2009) SONI, PRASHANTKUMAR SURESHBHAI; Pandya, P. R.India possess second largest population of Goats. Grazing goats are the backbone of most of the world's marginal land enterprises. They are capable of utilizing effectively a vast variety of plant species and vegetation types including unconventional feeds. Goats are normally habituated to eat vast variety of tree leaves which usually contain anti-nutritional factors like tannins. Their tannin tolerance is higher than other livestock. This may be due to speciaUzed microbial ecosystem. Present study was aimed to explore the effect of tannins on ruminal microbes using real time PCR approach. Tannins are most effective against the fiber-degrading (cellulolytic) bacteria like Fibrobacter succinogens, Riiminococcus species, Butyrivibrio fibrisolvens, Ruminobacter amylophilus. The ruminants which continuously feed upon diets rich in tannins usually develop a microflora which is tolerant to high tannins such bacteria includes Streptococcus capriniis, Streptococcus bovis, Selenomonas ruminantium, Clostridium species and class proteobacteria. The experiment was conducted on eight adult goats divided into 4 groups viz. Tl: control (0% acacia nilotica pods in TMR, 0% tannin), T2: 25% acacia nilotica pods in TMR (3.5% tannin), T3: 43% acacia nilotica pods in TMR (6% tannin) and T4: 59% acacia nilotica pods in TMR (8.5%) tannin). The Total Mixed rations with different levels of Acacia pods were produced and fed to respective goats ad lib. Rumen liquor (200 ml) was collected on 0, 15th and 30th day of experiment at 0, 3 and 6 hrs post feeding from each animal to study the effect of tannins on bacterial population. The bacterial DNA was extracted from pooled samples of both animals in each group by enzyme-chemical lysis method from rumen fluid. The DNA stock samples were quantified using Nano-drop spectrophotometer at 260 and 280 nm. Purity of DNA was judged on the basis of optical density ratio at 260:280 nm which was between 1.8 to 2.0 for all the samples indicating desirable purity. Species specific primers were used to amplify the bacteria (Selenomonas niminantium, Streptococcus bovis, Fibrobacter succinogenes, Treponema bryantii, Anaerovibrio lipolytica, Total Bacteria, Prevotella ruminicola, Ruminococcus albus, Methanobacteriales and Methanomicrobiales targeting 16S rRNA gene were used for amplification of DNA. The amplified products were visualized as a single compact band of expected size under UV light. The PCR products were purified by eluting the PCR product from the agarose using QIAquick Gel Extraction Kit - Qiagen and were ligated in pTZ57R/T vector of InsT/Aclone TM kit (Fermentas). This was followed by transformation into competent cells (DH5-α strain) of E.coli. Recombinant colonies were picked up by Blue white screening. White colonies were confirmed for presence of insert by colony PCR using M13 primers. Recombinant colonies were inoculated in Luria Broth for 16-18 hrs. Plasmid extraction from overnight culture was carried out by using QIAprep plasmid extraction kit. The plasmids contain species specific amplified DNA fragment so these plasmids were used as standards while running the real time PCR. Their copy number was calculated using optical density and molecular weight of plasmids. The plasmids were serially diluted and standard plot was prepared and according to the plot, the concentration of amplified DNA and ultimately the bacterial population was measured. All samples along with standard plasmids were amplified with species specific primers using real time PCR. The population of bacteria Selenomonas ruminantiwn increased with increase in level of tannins in different group (1314% increase in group IV followed by 747% and 210%) in group III and II respectively at 30th day of experiment) of animals and also with period of experimentation (Increased with 844%) and 1314% at 15th and 30th day respectively in group IV). Similarly the population of Streptococcus bovis also increased with increase in level of tannins and with period of feeding (555%o increase in group IV at 30th day). The lipolytic bacteria Anaerovibryo lipolytica increased with increase in level of tannins in feed (3645% increase in group IV). The results revealed Selenomonas ruminantium and Streptococcus bovis as tannin tolerant bacteria. Tarmins have inhibitory activity against fibrolytic bacteria Fibrobacter succinigenes and reduction in population was more prominent at 30th day of experiment (decreased by 73%, 67%) and 57% in group FV, III and II respectively). Similar inhibitory effect (78% decrease in group IV) was also seen in Treponema bryantii which is saccharolytic spirochete and has been shown to be associated with the fibrolytic bacteria of the rumen. The population of proteolytic bacteria Prevotella niminicola was not affected at any level of tannins throughout the experiment. At low level (3.5%), tannins have beneficial effect on microbial growth for total bacterial population but no effect was seen at other levels. The population of methanogens of the order Methanobacteriales and Methanomicrobiales also remain unchanged even at the highest level of tannins. The population of Ruminococcus albus increased at 15th day with the highest in group FV (496%) followed by group III (416%) and group II (308%). At 30th day the population decreased compared to 15th day but remained at higher level to that of 0 day population. The study revealed that Selenomonas ruminantium, Streptococcus bovis and Anaerovibrio lipolytica are major tannin tolerant bacteria in goats. Tannins exert detrimental effect on fibrolytic bacteria like Fibrobacter succinigenes and Treponema bryantii. However no effect of dietary tannins was observed on Prevotella ruminicola, Methanogenes (Methanobacteriales and Methanomicrobiales) and total bacterial population in goats.ThesisItem Open Access SINGLE NUCLEOTIDE EXTENSION ASSAY FOR CHARACTERIZATION OF DGAT1 LOCUS IN MEHSANA BUFFALO(AAU, Anand, 2009) PATIL, RAHUL CHAITRAM; Joshi, C. G.India, home ground of water buffalo (Bubalus bubalis) has 11 recognized breeds adapted to different climatic zones. The immense importance of this species due to contribution of more than 55 per cent to the total milk production and making country as number one milk producer in the world. Tremendous variation in production traits provokes buffalo genomic research to identify genes underlying the variability of milk production traits that could be useful in effective breeding programs. Present study was carried out with enormous interest in genotyping of Diacylglycerol acyltransferase 1 (DGATl) locus of Mehsana buffalo. The DGATl gene plays crucial role in triglyceride synthesis in the mammary gland which is proved by mice lacking both copies of DGATl gene are completely devoid of milk secretion and became a functional candidate gene for lactation traits. In the present study, five SNPs of DGATl gene of Indian water buffalo (GenBank-accession number DQ886485) with nucleotide position 1179, 1195 and 3096 (intron 1), 5545 (intron 2) and 6067 (intron 3) were selected for screening 64 Mehsana buffalo samples with the help of single nucleotide extension assay. According to principle of assay, unlabeled primers are hybridized to the DNA template just adjacent to respective SNP site and primer is extended by one base by DNA polymerase with fluorescence-labeled ddNTP terminators and further separated by capillary electrophoresis. Genomic DNA samples of Mehsana buffalo were subjected to DGATl specific PCR amplification using appropriate primer pairs and PCR products of expected size were successfully amplified at annealing temperature dO^C and then electrophoresed on 2 per cent agarose along with the MassRular Low range DNA ladder. Purified PCR products were subjected to single nucleotide primer extension with respective target DNA template and optimized under thermal cycling condition of armealing at 60°C and extension at 65°C for 25 cycles. Along with test samples, positive and negative control was also processed. All the SNaPshot PCR products then treated with CIAP and subjected to capillary electrophoresis on ABI PRISM 310 Genetic Analyzer along with LIZ 500 size standard for further analysis. The type of nucleotide present confirmed by the signal colour observed and length of final product obtained, by comparing with the size standard. The final length of each test primer extension product was judged by repeatedly running a single primer reaction and then determined consistently observed length of particular primer. Further (multiplex SNaPshot reaction was carried out using multiple primers with optimum concentration to determine the position and type of SNPs in single reaction. All the samples were found homozygous in both groups for SNP 1179, 1195 and 3096 with genotype AA, CC and CC respectively. This indicated that these alleles were fixed. Both the variants at nucleotide position 5545 (C and T) and 6067 (T and C) were observed. Allelic frequency was checked for both these SNPs and were found 0.85 (CC) and 0.15 (TT) for SNP 5545 while 0.57 (CC) and 0.43 (TT) for SNP 6067. Statistical analysis showed no significant association of these five SNPs with milk production traits like milk yield and milk fat percentage. All studied SNPs belonged to intronic regions however, may not be involved in manifestation of the traits.ThesisItem Open Access Diversity and molecular characterization of ruminal bacterial flora of goats(AAU, Anand, 2009) Patel, Jayesh M.; Jhala, M. K.Rumen harbors diverse types of microbes mainly bacteria followed by protozoa, fungi and yeast. Bacterial population as high as 10 power 10 is found in rumen and has a profound effect on nutritional and physiological processes in the host. Much of the pioneering studies on the rumen microbiota are based on microscopic examination and anaerobic culture techniques. But the polymiorphic nature and the difficulty of cultivating the microbes have hampered effective assessment of ruminal ecology by these methods. Newer molecular approaches are available to identify and characterize the bacteria that are based on detecting highly conserved 16S rRNA gene regions. Molecular characterization of rumen microflora in Indian goat apparently has not been carried out yet. Present study was aimed to determine diversity and molecular characterization of ruminal bacterial flora of goats using 16S r RNA gene amplification, cloning and sequencing of gene followed by phylogenetic analysis. Five goats reared at Instructional farm managed by Livestock production and management department at College of Veterinary Science and AH., Anand, were used for rumen liquor collection using a flexible stomach tube. The bacterial DNA was isolated from strained rumen liquor following enzyme-chemical lysis method The quality and quantity of DNA stock sample was determined using Nano-drop spectrophotometer and agarose gel electrophoresis. Universal primers for bacteria 27F (5'AGAGTTTGATCCTGGCTGGCTCAG 3') and 1492R (5' GGTTACCTTGTTACGACTT 3') targeting 16S rRNA gene were used for amplification of DNA. The amplified product was visualized as a single compact band of expected size (1346 bp) by gel documentation system. PCR product was subsequently eluted from agarose gel and ligated in pDrive vector followed by transformation into competent E. coli (DH5-a strain) cells. White recombinant colonies were selected (n=102), revived on fresh plates and screened for expected insert by colony PCR. Clones showing the amplification of 1346 bp DNA fragment were considered as positive clones (n=73) carrying desired insert of 16S rRNA gene. Screened products of colony PCR were subjected to Restriction Fragment Length Polymorphism (RFLP) analysis by Haelll and clones with common banding pattern were removed (n= 12) and remaining colonies (n=61) were used for plasmid extraction. The concentration of the plasmid was determined and was subjected to automated DNA sequencing on ABI PRISM® 310 Genetic Analyzer (Apphed Biosystems, USA) using BigDye® Terminator v3.1 Cycle sequencing kit. Sequences with good quality value (n=60) were selected for further analysis. Sixty sequences of good integrity were subjected to in silico processing by three ways viz. Similarity search using MEGA BLAST at NCBI nucleotide database, Taxonomic classification by Ribosomal Database Project (RDP) and Phylogenetic analysis. Out of 60 clones, 46 clones (77%) showed similarities in the range of 95-99%, nine clones (15%) in range of 90-94% and five clones (8%) showed less than 90% (of which four clones falling between 85-89%) similarities with NCBI nucleotide database. Five clones (8%) showed similarities with known bacterial species (viz. Ruminococcus albus, Ruminococcus flavefaciens, Prevotella multiformis {2 clones} and Butyrivibrio fibrisolvens), five clones (8%) showed similarities with known bacterial genera (viz., Ruminococcus, Prevotella, sad Bacillus {3 clones}). Taxonomic classification by RDP revealed that 60 clones were mainly distributed into two phyla, namely Bacteroidetes with 21 (35.0%) clones, Firmicutes with 20 (33.0%) clones, 17 (29%) clones fell under unclassified bacteria and two (3%) clones were grouped under unclassified root. Phylogenetic analysis using neighbour-joining method revealed three clones (5%) out of 60 as spp, two clones (3%) as genera, one clone (1.6%) as family and 27 clones (45%) as imcultured/unidentified rumen bacteria. Remaining 27 clones (45%) appeared to be novel, which showed distinct genetic grouping than the other reported sequences in the database. All the sequences were submitted to GenBank and are available with the accession numbers FJ970656 to FJ970715 in EMBL, GenBank and DDBJ Nucleotide Sequence Databases.ThesisItem Open Access CLINICAL STUDIES ON EPIDEMIOLOGY PATHOLOGY, DIAGNOSIS AND MANAGEMENT OF DOWNER COW SYNDROME(AAU, Anand, 2009) PATEL, BHAVIKA RAMESHBHAI; Patel, P. R.The downer cow syndrome is an emerging problem in high yielding cows. Management of such downer cows becomes a most challenging problem for any veterinarian. Downer cow syndrome is an extensively studied phenomenon all over the world but meager information has been reported in India. The present work on "Clinical Studies on Epidemiology, Pathology, Diagnosis and Management of Downer Cow Syndrome" was undertaken during the period starting from 1st October 2008 to 15th May 2009 in and around Anand town (Gujarat) to study the epidemiology and clinical management of downer cow syndrome. A total of 2,242 cows were at risk for downer cow syndrome, out of which 48 cows (2.14%) were found to be showing definitive signs of downer syndrome. Out of 48 downer cows, the highest incidence was recorded in more than a week recumbent downer cows (21 cases; 43.8%) followed by five days (11 cases; 22.9%), three days (10 cases; 20.8%) and one day (6 cases; 12.5%)). Out of 48 cases of downer cows syndrome, the incidence was recorded to be highest in Jersey crossbred (25 cases; 52.0%), followed by Holstein Friesian crossbred (15 cases; 31,2%), pure Holstein Friesian (5 cases; 10.4%), non -descript (2 cases; 4.2%) and pure Jersey (1 case; 2.0%). Out of 48 cases of downer cow syndrome, the highest incidences was recorded in high milk producers (23 cases; 48%), followed by average milk producers (22 cases; 46%)) and low milk producers (3 cases; 6%). Out of 48 cases of downer cow syndrome, the incidence was recorded to be highest in third and fourth lactation (22 cases; 46.2%)), followed by second lactation (10 cases; 20.7%), first lactation (9 cases; 18.5%), sixth lactation (5 cases; 10.5%) and fifth lactation (two cases; 4.1%). Type of housing and hygienic condition was not found to be correlated with the incidence of downer cow syndrome. Majority of the cows suffered from downer syndrome around calving or within a month post parturition. However, cases also occurred in late lactation, advance pregnancy and other physiological states. Downer cows were found into two categories clinically alert downers (41 cases; 85.4%) and non alert downers (7 cases; 14.6%). The alert downers were bright and alert with normal or slightly reduced appetite. The body temperature, rumination, urination and defecation were normal. The heart and respiratory rates were normal except few cows which had accelerated heart and respiratory rates (12 cases; 29.2%). Such cows tried to get up from front but were unable to raise their hind quarters. Characteristic crawling was also observed in fourteen (31.1%)) downer cows. The non-alert downers preferred lateral recumbency and they were completely anorectic with accelerated heart and respiratory rates. Haematologically, the downer cows had significantly (p<0.05) decreased Hb (7.90 ± 0.45), PCV (24.65 ± 1.26) and TEC (4.77 ± 0.15). Whereas significant (p<0.05) increased MCV (62.43±1.25), decreased MCHC (27.61 ±1.30), relatively neutropliiiia (44.12±1.97) and lymphopenia (52.83±2.12). The concentration of blood glucose (104.14 ± 6.57), BUN (20.00 ± 1.89) and creatinine (3.62 ± 0.53mg/dl) were significantly higher in downer cows. The activities of serum enzymes like AST (196.95 ± 19.41), ALT (57.41±7.84), CPK (14.93±1.07) and LDH (503.91 ±6.42) were significantly (p<0.05) higher in downer cows. Downer cows had significantly (p<0.05) low calcium (7.58±0.26), phosphorus (3.84±0.13), magnesium (2.82±0.09) and potassium (3.15±0.18) concentration. Majority of downer cows suffered from net deficiency of calcium, phosphorus, potassium and magnesium while some had combined deficiency. The Cortisol level (151.00±0.48) significantly (p<0.05) elevated in downer cow syndrome. Histopathologically, necrosis of muscle, demyelinization as well as loss of axon of nerves and degenerative changes in heart, liver, and kidney were characteristic features. In order to understand and formulate suitable diagnosis and therapeutic measures; clinical symptoms, haematology, biochemical profile, enzymes, minerals and electrolyte were studied on 48 cows suffering form downer cow syndrome. With combined therapy consisting of calcium, phosphorus, magnesium and nervine stimulant at parenteral route with manual change of sides, massage of limbs and lifting of animals manually or with the help of sling on two-three occasions a day, success could be gained in 52 per cent downer cows (25 out of 48). The downer thus treated showed clinical recovery within a period of 3-40 days.ThesisItem Open Access EFFECT OF DIFFERENT CATEGORIES OF SERA AND BOVINE SERUM ALBUMIN ON IN VITRO MATURATION OF SURTI BUFFALO OOCYTES(AAU, Anand, 2009) MISTRY, CHIRAG NATAVARLAL; Dhami, A. J.This study was conducted over a period of 6 months from September 2008 to February 2009 with the objectives of evaluating the effects of different concentrations (0.05, 0.1, 0.3, 0.6 and 0.9 per cent) of BSA-FAF and also of different categories of sera like Fetal Calf Serum (Gibco), Fetal Buffalo Serum, Oestrus Buffalo Serum, Postoestrus Buffalo Serum and Anestrus Buffalo Serum (all @ 20%) in relation to standard BSA (0.6%) on in vitro maturation of buffalo oocytes in TCM-199 medium. The rate of maturation was confirmed both by cytoplasmic and nuclear maturation using Hoechst stain 33342. A total of 456 ovaries of Surti buffaloes collected from the local slaughter house were transported to the laboratory at 30°C in normal saline solution within I72 hours of slaughter of animal for further processing. In all 1409 oocytes were recovered from them by using slicing method of surface follicles. The sera samples used for culture were obtained from the animals showing different stages of oestrous cycle and were heat inactivated in the laboratory. An average number of follicle of small, medium and large size found per ovary was 0.82, 0.48 and 0.24, respectively, with an overall mean of 1.55. The distribution of these follicles came to 53.18, 31.12-and 15.70 percent, respectively. The slicing method of oocyte recovery gave quite good result. The average oocyte recovery was 3.09 per ovary. The average recovery rate of Grade A, Grade B and Grade C oocyte was 1.02,1.22 and 0.85, respectively. The maturation rate with 0.05, 0.1, 0.3, 0.6 and 0.9 per cent concentration of BSA in TCM-199 was found to be 44.52, 50.99, 59.02, 84.43 and 64.29 per cent, respectively. The BSA 0.6 per cent yielded the highest maturation rate, which differed significantly from other BSA concentrations. The maturation rate for locally prepared FOBS, AnBS, FCS (Gibco), FBS and OBS was found to be 64.63, 54.55, 70.63, 60.48 and 78.16 per cent, respectively. The medium containing oestrus buffalo serum yielded significantly higher (P<0.05) maturation rate than the others, though it was little less than the BSA 0.6. The highest maturation of Grade A oocytes was found in BSA 0.6 followed by OBS and other sera. While in Grade B it was in BSA 0.9 followed by BSA 0.6, and for Grade C oocytes the highest maturation rate was with BSA 0.6 followed by FOBS. According to nuclear maturation, the highest number of oocytes with germinal vesicle was found in medium containing FBS (25.21 %) followed by AnBS and others. The highest number of germinal vesicle break down was found in FOBS (30.61 %) followed by FCS (Gibco) and others. The higher number of oocytes with Metaphase-I was in the medium containing BSA 0.6 per cent (22.13 %) followed by FCS (Gibco), while, the Metaphase-II stage was found to be higher in medium containing OBS (41.38 %) followed by BSA 0.6 and others. Degenerated oocytes were maximum with BSA 0.05 per cent (40.41 %) and minimum with OBS (9.20 %). It was concluded that BSA concentration of 0.6 per cent is the optimum for in vitro maturation of buffalo oocytes, and that OBS can be used instead of BSA as a cheaper and easily available source of serum for in vitro maturation of buffalo oocytes.ThesisItem Open Access ISOLATION AND CHARACTERIZATION OF AEROMONAS SPECIES FROM POULTRY MEAT(AAU, Anand, 2009) SMITA; Brahmbhatt, M. N.The aim of the present study was to isolate, identify and characterize Aeromonas species from poultry meat. A total of 120 samples were processed for estimating prevalence oi Aeromonas spp. Out of those 120 samples, 66 isolates oi Aeromonas were identified. On the basis of biochemical characterization 47 isolates of A. sobria, 11 isolates of A. hydrophila and 8 isolates of A. caviae were detected. When the source wise study of Aeromonas was conducted it was found that maximum number of Aeromonas isolates were recovered from heart (87.5 per cent) followed by liver (66.66 per cent), thigh muscle and chest muscle (40 per cent each). When different selective culture media were evaluated for isolation of Aeromonas spp. from poultry meat it was found that percent recovery of Aeromonas isolates were more from Ampicillin Dextrin Agar (89.39 per cent), followed by Aeromonas Starch DNAse agar (68.18 per cent) and Aeromonas isolation media (18.18 per cent). Specificity of PCR assay for detection of A. hydrophila and A. sobria was performed by testing against different gram positive and gram negative organisms.Primers were found to be specific for A. hydrophila and A. sobria. All the isolates of A. sobria (47) and A. hydrophila (11) which were identified on the basis of biochemical characterization were subjected to PCR and confirmed. All 66 Aeromonas isolates were tested for presence of aerolysin, haemolysin and enterotoxin gene. None of the isolate showed presence of aerolysin and enterotoxin while overall prevalence of haemolysin gene was 78.78 per cent. In A. hydrophila, 54.54 per cent; A. caviae, 37.5 per cent and in A. sobria, 91.48 per cent isolates were found to possess haemolysin gene. All the isolates of Aeromonas were subjected to antimicrobial drug sensitivity test against gentamicin, chloramphenicol, ciprofloxacin, kanamycin, bacitracin, rifampicin, tetracycline and erythromycin. Maximum sensitivity pattern was recorded with chloramphenicol (86.36per cent), gentamicin (81.82 per cent), ciprofloxacin (60.61 per cent), kanamycin (34.85 per cent), bacitracin (25.76 per cent), tetracycline (16.67 per cent), rifampicin (15.15 per cent) and erythromycin (9.09 per cent). The resistance pattern of Aeromonas isolated from chicken meat to various antibiotics was observed as bacitracin (74.24 per cent) followed by rifampicin (71.21 per cent), kanamycin (65.15 per cent), erythromycin (53.03 per cent), tetracycline (33.33 per cent), ciprofloxacin (22.73 per cent) and gentamicin (18.18 per cent). It was concluded that overall prevalence of Aeromonas spp. in poultry meat was 55 per cent which is a matter of concern from public health point of view and needs proper attention. The overall prevalence of 78.78 per cent of Aeromonas isolates showing presence of haemolysin gene (Virulence gene) in poultry meat is also a matter of concern and this study reveals that poultry meat could be a potential threat to public health. Hence, more attention for implementation of HACCP concept from food safety point of view is required. Antibiotic sensitivity pattern of Aeromonas isolates revealed that chloramphenicol was found to be most effective drug (86.36per cent) followed by gentamicin (81.82 per cent), ciprofloxacin (60.61 per cent), kanamycin (34.85 per cent), bacitracin (25.76 per cent), tetracycline (16.67 per cent), rifampicin (15.15 per cent) and erythromycin (9.09 per cent).ThesisItem Open Access INFLUENCE OF SUPPLEMENTING BYPASS FAT DURING EARLY LACTATION ON MILK PRODUCTION IN BUFFALOES(AAU, Anand, 2009) BHORANIYA, V. P.; Parnerkar, SubhashTwelve Mehsani buffaloes in their 2nd and 3rd lactation were selected to conduct on-farm trial at the Chikhodra village of Anand district for 120 days. The animals were selected on the basis of their average daily milk yield, fat % and body weight. The experiment was initiated on 15th day of lactation. The experimental animals were randomly allotted to two dietary treatments i.e. T1 (Control) and T2 (Bypass Fat) of six animals in each group, following Completely Randomized Design. All the experimental buffaloes were individually offered a basal diet of home- made concentrate mixture and wheat straw and paddy straw ad lib to meet their protein and energy needs for maintenance and for milk production as per NRC (2001). The commercial bypass fat supplement, Megalac, manufactured by M/s. Vetcare India Ltd., Bangalore, was provided to buffaloes in T2 group @ 200g/head/day. The experimental buffaloes produced on an average 9.52 ± 0.47 and 9.97 ± 0.34 kg whole milk/head/day, under T1 and T2 groups, respectively. The treatment groups differed significantly (P<0.05) from each other. The milk fat of experimental buffaloes in T1 and T2 groups was 6.39 ± 0.19 and 7.14 ± 0.19 %, respectively. The treatment groups differed (P<0.05) from each other. The TS and SNF % of milk was 15.82 ± 0.35, and 16.30 ± 0.27 and 9.43±0.19 and 9.15±0.13, respectively in T1 and T2 groups, which was statistically similar in both the groups. The daily yield of 6% FCM was 12.21±0.70 and 13.94±0.55 kg in T1 and T2 groups, which was significantly higher (P<0.05) in T2 as compared to T1 group. The dietary treatments were found statistically similar with respect to the digestibility coefficient (%) of OM, CP, CF and NFE. However, DM and EE digestibility was higher (P<0.05) in T2 as compared to T1 group. The CP and TDN content of composite diets in T1 and T2 groups was 10.22 ± 0.03 and 10.05 ± 0.01 and 56.57 ± 1.77, and 59.48 ± 0.76 %, respectively. The average daily CP and TDN intake as per cent of requirement (NRC, 2001) of experimental buffaloes were satisfactory during digestion trial conducted at the end of experiment. The FCE of buffaloes in T1 and T2 groups in terms of DMI (kg/kg milk) was 1.61 ± 0.04 and 1.50 ± 0.02 and in terms of CPI (g/kg milk) was 164.48+ 3.86 and 151.15± 2.26 in T1 and T2 groups, respectively, which was significantly higher (P<0.05) in T2 group. However, FCE in terms of TDNI (kg/kg milk) was did not differ statistically. The treatment groups T1 and T2 significantly differ (P<0.05) from each other with respect to the conversion efficiency of DM (1.55± 0.06, and 1.34 ± 0.05 kg), CP (158.16± 4.00, and 134.78± 2.91 g) and TDN (0.87 ± 0.02, and 0.80 ± 0.03 kg) into one kg 6% FCM. The service period of buffaloes was 118.33 ± 5.39 and 77.75 ± 7.09 days in Tj and T2 groups, respectively. The service period was lower by 40.58 days in T2 as compared to T1 group. The daily feed cost (Rs. /head) in T1 and T2 was 87.63 ± 3.17 and 95.34 ±1.87, respectively and was statistically higher (P<0.05) in T2 than T1 group. The data on daily realizable receipt from sale of milk (Rs/head) was 168.51 ± 12.6 and 197.04 ± 11.29 in T1 and T2 groups, respectively and the treatment groups differed (P<0.05) from each other. Accordingly, the daily return over feed cost (Rs./head) was 80.88 ± 7.27 and 101.71±6.50 in T1 and T2 groups, respectively. The same was significantly higher (P<0.05) in T2 as compared to T1 group. The improved reproductive performance on account of supplementation of bypass fat was exhibited in reduced service period in T2 (77.75 ± 7.09 days) as compared to T1 (118.33 + 5.39 days) The saving in feed cost (Rs./head) due to reduced service period (40.58 days) worked out as Rs. 3556.03 in T2 over that in control group. The net difference due to ROFC and due to improved service period put together worked out as Rs. 6055.21 in T2 group over control during experimental period of 120 days. These data indicate the importance of feeding bypass fat results in improvement in fat, total solids % (TS), yield of fat and 6% FCM, reproduction and net return from buffaloes during their early lactation.ThesisItem Open Access THERAPEUTIC EFFECT OF EPIPLEURAL AND VISCERAL PROCAINE BLOCKADE IN PRIMARY INDIGESTION CASES OF BUFFALOES (Bubalus bubalis)(AAU, Anand, 1991) Shah, Dharmendra A.; Parsania, R. R.The cases admitted to Veterinary College Hospital, Anand and Ambulatory Clinic centres at Chikhodra, Gamdi and Bedva villages were studied and 50 oases of primary indigestion were selected for therapeutic trials. The cases were grossly diagnoses on the basis of history, clinical findings and faecal sample examination. These 50 animals were divided equally into five treatment trial groups via., (a) epipleural procaine blockade (b) viscera procaine blockade (c) conventional method supplemented with epipleural procaine blockade (d) conventional method supplement with visceral procaine blockade and (e) conventional method onl Clinical observations regarding overall behaviour of the animal, its expression, ruminal motility, heart rate, respiratiorate and rectal temperature were studied before and 48 hours aft the treatment in all the five groups of buffaloes. Haematologica parameters (Hb, PCV, TEC, TLC and DLC), biochemical parameters (blood glucose and BUN) and rumen fluid analysis (colour, odour, pH, protozoal motility and total volatile fatty acids concentrate were also studied before and 48 hours after the treatment. However, in all the parameters, the changes were found non-significant and remained within their normal physiological limits. Depending upon the efficacy and the rapidity with which the cases got cured, the present study has definately indicated that the procaine blockade was better than the conventional treatment. Among procaine blockades also, the visceral procaine blockade was found to be superior and practical method having wide field applicability. The present study was restricted to fifty clinical cases of primary indigestion only. But looking to the results achieved this visceral procaine blockade can be employed in more number of cases and also in variety of conditions, which may throw a light on some hidden efficacy of the same. So, further study is needed for better understanding of the blockade and i t s wide sprea uses in veterinary practices.ThesisItem Open Access EFFECT OF CLOMIPHENE CITRATE (FERTIVET FVT 300) ON SEXUAL BEHAVIOUR AND SEMEN QUALITY IN SURTI BUFFALO BULLS(AAU, Anand, 1991) Doshi, M. B.; Derashri, H. J.The present study was undertaken to evaluate the effect of clomiphene citrate (Fertivet FVT 300) on sexual behaviour, semen quality and quantity and level of testosterons in eight Surti buffalo bulls. The experiment was divided into three phases : pre-treatment, during treatment and post-treatment; each of eight weeks keeping equal number of bulls as control. Significant (P /0.05) effect of treatment was observed on reaction time, semen volume, total sperm count, total solids, total protein, citric acid, potassium and (P /0.01) serum testosterone level. Sustained significant effect of treatment was observed on citric acid (P /0.05) and serum testosterone level (P /0.01) during post-treatment phase. Significant (P /0.05) correlations due to treatment were observed between reaction time (negative), colour and consistency; (P /0.01) total protein, citric acid and initial fructose and testosterone. It was concluded that treatment with clomiphene citrate increased the testosterone levels in blood which reduced the reaction time and increased the sperm concentration to a threshold level and activity of accessory sex glands. Post-treatment effects sustained only for few weeks.