Loading...
Thesis
Browse
485 results
Search Results
ThesisItem Unknown EFFECT OF ROOTING MEDIA AND IBA ON RHIZOGENESIS AND GROWTH OF TERMINAL CUTTINGS IN BER (Ziziphus mauritiana Lamk) Cv. APPLE BER(COLLEGE OF HORTICULTURE,VENKATARAMANNAGUDEM W.G. Dist. – 534 101 ANDHRA PRADESH, 2019-10-19) MAHESH S S N MOKHAMATLA; Dr. A. HARSHAVARDHANThe present investigation entitled “Effect of rooting media and IBA on rhizogenesis and growth of terminal cuttings in ber (Ziziphus mauritiana Lamk) cv. Apple ber” was carried out during the period from October, 2018 to March, 2019 under the supervision of the Department of Fruit science, College of Horticulture, Venkataramannagudem. This trial was conducted in a mist chamber available at Kadiyadda village, Tadepalligudem mandal, West Godavari District, Andhra Pradesh with an objective of finding out the best type of rooting media, IBA concentrations and methods of application for successful propagation. The terminal cuttings were planted in three types of media viz., coco peat, vermiculite and saw dust, treated with IBA at three concentrations i.e., 1000 ppm, 1500 ppm and 2000 ppm. Methods of application two types i.e., cuttings treated with mixture of IBA and talcum powder and cuttings treated with IBA solution for 5 minutes. The experiment was conducted in Factorial Completely Randomized Design with the above three factors at unequal levels and replicated thrice. The study revealed that significant difference among rooting media, IBA concentrations, methods of application and their interactions for different root and shoot parameters. Among the three rooting media, coco peat performed superior for different root and shoot parameters. Among the IBA concentrations and methods of application, the one at 1000 ppm with IBA solution for 5 minutes method was found to be superior among the interactions in respect of different root and shoot parameters. The root parameters were significantly influenced by main treatment factors as well as their interactions from 60 days after planting onwards. At 120 DAP, number of roots per cutting, length of the longest root per cutting, fresh weight of roots per cutting and dry weight of roots per cutting were found to be maximum in those terminal cuttings planted in coco peat media, IBA @ 1000 ppm and cuttings treated with IBA solution for 5 minutes as well as their combination. Similar trend was observed in case of shoot parameters also at 120 days as evident from the results on number of shoots per cutting, length of longest shoot per cutting, number of leaves per cutting, fresh and dry weight of shoots per cutting, root to shoot ratio (on dry weight basis). Percentage of rooted cuttings during hardening process, days to first sprouting of terminal cuttings at 45 and absolute growth rate and days taken for plantable size at 90 days after planting were recorded. From the present investigation, it can be concluded that the terminal cuttings planted in coco peat media, IBA @ 1000 ppm and cuttings treated with IBA solution for 5 minutes gave pronounced effect on root and shoot formation indicating its effectiveness for propagation in ber cv. Apple ber .ThesisItem Unknown “STUDIES ON COMBINED INFLUENCE OF PRUNING AND EXOGENOUS APPLICATION OF GROWTH REGULATORS ON FLOWERING AND FRUITING BEHAVIOUR OF SWEET ORANGE (Citrus sinensis Swingle) cv. SATHGUDI”(COLLEGE OF HORTICULTURE ANANTHARAJUPETA -516 105, YSR KADAPA DISTRICT ANDHRA PRADESH, 2019-09-19) DUPATI ASHOK KUMAR; Dr. V.N.P. SIVA RAMA KRISHNAA field investigation entitled “Studies on combined influence of pruning and exogenous application of growth regulators on flowering and fruiting behaviour of Sweet Orange (Citrus sinensis Swingle) cv. Sathgudi” was conducted at Fruit science block, sweet orange orchard, College of Horticulture, Anantharajupeta, Dr. Y.S.R.H.U. during the year of 2018-19. The experiment was laid out in factorial randomized block design with twelve treatments with single control and replicated thrice. This interaction study was conducted with three major objectives viz, to analyze the combined influence of pruning and exogenous application of PGRs on vegetative growth, initiation of flowering, on fruiting behavior, fruit yield and quality in sweet orange. Among the different interaction treatments tested, to initiate flowering, improve behavior and quality improvement in sweet orange (Citrus sinensis Swingle) cv. Sathgudi, T2 (P1C2 – Pruning 10 cm + NAA @ 100 ppm) recorded less number of days taken for flowering, more number of flowers per shoot, maximum flowering percentage, highest flower retention percentage, maximum fruit set percentage, more number of fruits per shoot, more number of fruits per tree, minimum fruit drop percentage, highest fruit yield per tree, less peel to pulp ratio, highest juice content, maximum total soluble solids, low titrable acidity, more ascorbic acid content and maximum total sugars content. Maximum shoot length and fruit length were recorded in T4 (Pruning 10 cm + GA3 @ 100 ppm). Maximum fruit volume was noticed in T1 (Pruning 10 cm + NAA @ 50 ppm). Minimum number of seeds per fruit was observed under T11 (Pruning 15 cm + 2% KNO3). Maximum fruit weight and highest reducing sugars content were recorded in T9 (Pruning 15 cm + GA3 @ 50 ppm). Highest fruit volume and maximum fruit diameter were measured under T1 (Pruning 10 cm + NAA @ 50 ppm). Less peel thickness and minimum peel weight were noticed under T12 (Pruning 15 cm + 3% KNO3). It can be concluded from the present study, those among all the interaction treatments, T2 (P1C2 – Pruning 10 cm during the second week of September + NAA @ 100 ppm in two sprays during October at fortnightly intervals) was the best for early flowering, fruit growth and development and quality parameters of sweet orange.ThesisItem Unknown EFFECT OF INORGANIC FERTILIZERS IN COMBINATION WITH BIOFERTILIZERS ON GROWTH, YIELD AND QUALITY OF BEETROOT (Beta vulgaris L.) cv. CRIMSON GLOBE(COLLEGE OF HORTICULTURE, VENKATARAMANNAGUDEM, W.G.Dist.-534 101 Dr. Y. S. R. HORTICULTURAL UNIVERSITY, 2019-09-14) TAMARAPALLI BALARAJU; Dr. G. NARASIMHA MURTHYAn investigation on “Effect of inorganic fertilizers in combination with biofertilizers on growth, yield and quality of beetroot (Beta vulgaris L.) cv. Crimson Globe” was carried out during Rabi season, 2018-2019 at college farm, College of Horticulture, Dr. Y.S.R. Horticultural University, Venkataramannagudem, West Godavari District, Andhra Pradesh. The experimental design adopted was Factorial RBD. The first factor adopted was the inorganic fertilizers at three levels (100%, 75% and 50% of RDF) and the second factor was the different methods of biofertilizers (Azotobacter + PSB + KSB as seed treatment, soil application and seed treatment along with soil application and without biofertilizers). The experiment included 12 treatment combinations of inorganic fertilizers along with the biofertilizers. The studies on the application of inorganic fertilizers on beetroot cv. Crimson Globe revealed significant differences among the various levels. The application of 100% recommended dose of fertilizers (70:110:70 NPK kg/ha) recorded maximum plant height, plant spread in N-S, E-W directions, number of leaves per plant, leaf area and leaf area index, root length (10.66 cm) and diameter (6.41 cm), fresh weight of root (152.25 g) and dry weight of root (30.45 g), TSS, protein content, nitrogen uptake, phosphorus uptake and potassium uptake. The crop applied with biofertilizers, Azotobacter + PSB + KSB as seed treatment and soil application showed significant increase in plant height, number of leaves per plant, leaf area, leaf area index, root length (11.12 cm), root diameter (6.65 cm), yield per plot (6.30 kg), yield per hectare (21.78 t), TSS, ascorbic acid and protein content and also nutrient uptake. From the experiment it was revealed that the treatment combination of 100% RDF and biofertilizers i.e. Azotobacter + PSB + KSB as seed treatment and soil application recorded highest values in terms of growth characters viz., plant height, number of leaves, leaf area, leaf area index, root and yield characters viz., root length (12.33 cm), root diameter (7.21 cm), fresh weight of root (187.03 g), dry weight of root (37.40 g), harvest index (78.57%), yield per plot (7.20 kg), yield per hectare (24.92 t) and quality characters of the crop viz., TSS, ascorbic acid and protein content. The nutrient status was found to be highly influenced by various combinations of inorganic fertilizers and biofertilizers and recorded significant increase in terms of nitrogen uptake (118.33 kg ha-1 ), phosphorus uptake (18.18 kg ha-1 ) and potassium uptake (99.67 kg ha-1 ). This combination also recorded highest benefit cost ratio of 3.17.ThesisItem Unknown MOLECULAR IDENTIFICATION AND MANAGEMENT OF FUSARIUM WILT PATHOGEN IN CHRYSANTHEMUM (Dendranthema grandiflorum Tzelev)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA - 516 105, Y.S.R KADAPA DISTRICT, ANDHRA PRADESH, 2019-07-08) N. UMALATHA; Dr. CH. RuthThe present investigation entitled ʽʽMolecular identification and management of Fusarium wilt pathogen in chrysanthemum (Dendranthema grandiflorum Tzelev)ʼʼ was carried out at College of Horticulture, Anantharajupeta during the year 2018-2019. A roving survey was conducted to record Fusarium wilt incidence under field conditions in Kadapa, Chittoor, Ananthapuramu and Kurnool of Andhra Pradesh (A.P.). The maximum mean disease incidence was observed in Kadapa district (24.68%) followed by Chittoor district (19.85%), Ananthapuramu district (15.78%), whereas, minimum mean disease incidence was observed in Kurnool district (6.95%). The wilt pathogen of Fusarium oxysporum f. sp. chrysanthemi was isolated from collar region of infected chrysanthemum plant and their pathogenicity proved. Based on cultural and morphological characters, of isolates were identified as Fusarium oxysporum f. sp. chrysanthemi (NCFT, 9374.18) and confirmed by National Centre for Fungal Taxonomy (NCFT), New Delhi. Molecular characterization was conducted for Fusarium oxysporum f. sp. chrysanthemi. For identification of pathogen at molecular level, the genomic DNA was amplified with universal primes ITS 1 (TCCGTAGGTGAACCTGCGG) and ITS 4 (TCCTCCGCTTATTGATATGC). From the results obtained, the genomic DNA amplified at a 562 bp. Sequences were analysed through NCBI-BLAST programme database search system. BLAST (mega blast) analysis for sequence similarity of ITS rDNA region confirmed the identity of the pathogen. Sequence was deposited in NCBI, the Accession number (MK956193) for that sequence. Phylogenetic tree was constructed by using neighbour-joining method and maximum likelihood for the ITS regions. Results from the BLAST (Mega blast) data base showed, that the studied isolate have 98% similarity with Name of the author : N. UMALATHA Title of the thesis : ʽʽMolecular identification and management of Fusarium wilt pathogen in chrysanthemum (Dendranthema grandiflorum Tzelev)ʼʼ Degree to which it is submitted : M.Sc. (HORTICULTURE) Faculty Department : : HORTICULTURE PLANT PATHOLOGY Major Advisor : Dr. Ch. RUTH University : Dr.Y.S.R. HORTICULTURAL UNIVERSITY Year of submission : 2019 Fusarium oxysporum (Genbank KJ082096.1) and Fusarium sp. (Genbank ID - KU612374.) Rhizosphere antagonists (Bacteria, fungi and actinomycetes) were isolated from healthy rhizosphere soil samples collected from Kadapa, Chittoor, Ananthapuramu and Kurnool of Andhra Pradesh (A.P.). A total of 25 rhizosphere microbes were isolated. Among these, 20 isolates, seven fungi (RFA1 Phoma glomerata, RFA2 Aspergillus niger strain 1 RFA3 Aspergillus fumigates, RFA4 Aspergillus niger strain2 , RFA5 Aspergillus nidulans, RFA6 Aspergillus flavus strain 1, RFA7 Aspergillus flavus strain 2 ) three bacteria (RBA1 Bacillus cereus, RBA2 and RBA3) and three actinomycetes (RA1Streptomyces griseus, RA2 Streptomyces griseolus and RA3 Streptomyces griseoflavus)were found to exhibit antagonism against chrysanthemum wilt pathogen. Molecular identification of effective rhizosphere bacterial antagonists (RBA1) was conducted by the use of primers, 27F(AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTTS) the bacteria were identified as Bacillus cereus which have amplified at 874 base pairs. They were sequenced and the sequenced nucleotides were compared against Gen Bank database using the NCBI BLAST algorithm, the BLAST results shown the 88% similarity of the isolate (RBA 1) with Bacillus cereus. Among the rhizosphere antagonistic fungi, recorded highest inhibition over control, RFA 5- Aspergillus nidulans (84.68%), bacterial antagonist RBA 1- Bacillus cereus (65.88%) and rhizospheric actinomycetes RA1- Streptomyces griseus (70.74%) were more antagonistic against F.oxysporum f. sp. chrysanthemi respectively. An in vitro experiment was conducted on Fusarium oxysporum f. sp. chrysanthemi with five fungicides, viz., Copper oxy chloride 50% WDP, Carbendazim 12% + Mancozeb 64% WP, CuSO₄ + Lime + Water (Bordeaux mixture), Thiophanate methyl, Difenconazole 25% EC for their inhibitory effect. Among the fungicides, tested against pathogen Carbendazim + Mancozeb concentration (0.1% 0.2% 0.3%) and Difenconazole at (0.2%) showed 100 per cent inhibition against Fusarium wilt pathogen. The compatibility of the effective rhizosphere fungal antagonist Aspergillus nidulans (RFA 5) and effective rhizosphere bacterial antagonist Bacillus cereus (RBA1) to five fungicides viz., Copper oxy chloride 50% WDP, Carbendazim 12% + Mancozeb 64% WP, Bordeaux mixture, Thiophanate methyl, Difenconazole 25% EC were assessed. Copper oxychloride (0.3%) and Bordeaux mixture (0.5%) are more compatible with Aspergillus nidulans and Carbendazim 12% + Mancozeb 64% WP, Thiophanate methyl, Difenconazole 25% EC were compatible with Bacillus cereus. The most effective treatments proved effective under in vitro studies were tested against Fusarium oxysporum f. sp. chrysanthemi under pot culture conditions. Among the six treatments, recorded lowest disease incidence in the treatment T1- soil application of Streptomyces griseus (27.00%) and T2 - soil application of Streptomyces griseolus (27.25%) were the most effective antagonists respectively.ThesisItem Unknown STUDIES ON STANDARDIZATION OF PROTEIN FORTIFIED PAPAYA BASED MIXED FRUIT BAR(COLLEGE OF HORTICULTURE, VENKATARAMANNAGUDEM, W.G.Dist.- 534 101 ANDHRA PRADESH, 2019-09-16) SATYALA LAKSHMI PRIYANKA; Dr. V. SUDHA VANIThe present investigation entitled “Studies on standardization of protein fortified papaya based mixed fruit bar” was carried out in the Department of Post Harvest Technology at College of Horticulture, Dr.Y.S.R. Horticultural University, Venkataramannagudem, West Godavari District of Andhra Pradesh during September 2018 to March 2019 with an objective to study the effect of pulp blends, packaging materials and protein concentrations on quality and shelf life of protein fortified papaya based mixed fruit bar and also to assess the economic viability of different fruit blends, packaging material and protein concentrations of papaya based mixed fruit bar. Two experiments were conducted in Factorial Completely Randomized Design with factors viz., fruit blends and packaging materials at unequal levels and replicated thrice. The physico-chemical properties and organoleptic quality of protein fortified papaya based mixed fruit bar were evaluated at 30 days intervals up to 90th day of storage period. It was observed that moisture content, total soluble solids, reducing sugars and titrable acidity showed increasing trend throughout the storage period whereas, the non-reducing sugars, total sugars, protein, ascorbic acid, beta carotene and organoleptic characteristics exhibited decreasing trend during storage of the protein fortified papaya based mixed fruit bar. In the first experiment, among the pulp blends and packaging materials, the fruit bar prepared from 50% papaya pulp+10% banana pulp+40% sapota pulp packed in PET bottles (B1P1) was superior in terms of low moisture percentage (15.10%) and better retention of TSS (81.25oB), reducing sugars (42.07%), total sugars (68.23%), non reducing sugars (26.16%), flavour (8.83), texture (8.87), taste (8.86) and overall acceptability score (8.88). The fruit bar prepared from the 100% papaya pulp (B5) recorded high content of ascorbic acid (63.86 mg/100g), beta- carotene (1595 µg/100g), colour score (8.85) and appearance score (8.92). The bar prepared with 50% papaya pulp+40% banana pulp+10% sapota pulp packed in PET bottles (B4P1) recorded the high protein (0.84%) and titrable acidity (1.53%). B:C ratio was high (3.08) in the fruit bar prepared from 50% papaya pulp+10% banana pulp+40% sapota pulp packed in LDPE covers (B1P2). In the second experiment, among the protein concentrations, the fruit bar prepared from 50% papaya pulp+10% banana pulp+40% sapota pulp fortified with 5% whey protein (C1) was recorded as most acceptable treatment throughout the storage period from initial day to 90th day of storage at ambient conditions. It has recorded higher retention of titrable acidity (1.24), taste (8.89), texture (8.87), flavour (8.89) and overall acceptability score (8.57). The fruit bar prepared with 50% papaya pulp+10% banana pulp+40% sapota pulp and fortified with 20% whey protein packed in PET bottles (C4) was observed high content of TSS (82.11oB), reducing sugars (44.53%), non reducing sugars (4.47%), total sugars (68.28%) and protein (15.48 %). The fruit bar prepared with 50% papaya pulp+10% banana pulp+40% sapota pulp fortified with 5% soya protein (C5) has recorded low moisture content (15.57%), ascorbic acid (43.06 mg/100g), high colour and appearance values (8.85 and 8.89), respectively. Maximum B:C ratio (2.80) was recorded in the fruit bar prepared with 50% papaya pulp+10% banana pulp+40% sapota pulp and fortified with 20 % whey protein packed in PET bottles (C4).ThesisItem Unknown EFFECT OF PRETREATMENTS AND DRYING METHODS ON THE QUALITY CHARACTERISTICS AND SHELF LIFE OF TOMATO (Solanum lycopersicum L.) POWDER(COLLEGE OF HORTICULTURE VENKATARAMANNAGUDEM, W.G.Dist. – 534 101 ANDHRA PRADESH, 2019-09-15) MIRIYALA DIVYA; Dr. D. V. SWAMIThe present investigation entitled “Effect of pretreatments and drying methods on the quality characteristics and shelf life of tomato (Solanum lycopersicum L.) powder” was carried out during December 2018 to April 2019, at Postharvest Technology Research Station, Dr. Y.S.R. Horticultural University, Venkataramannagudem, A.P. The experiment was carried out with an objective to find out the best pretreatment and drying method for improving the quality and shelf life of tomato powder. Four pretreatments viz., 2% CaCl2, 0.2% KMS, 2% NaCl and control and four drying methods viz., mechanical drying, solar drying, sun drying and spray drying were used in this experiment. The experiment was conducted in Completely Randomized Factorial Design with the above two factors and replicated twice. The physico-chemical characteristics and shelf life of tomato powder was evaluated at 15 days interval up to 90 days of storage period. It was observed that lycopene content, non-reducing sugars, ascorbic acid content, pH, rehydration ratio, colour, taste, flavour, texture and overall acceptability showed decreasing trend from initial day to 90 days of storage, whereas the moisture content, total sugars, reducing sugars, titrable acidity, water activity, microbial count and non-enzymatic browning showed increasing trend during storage of tomato powder. Among the pretreatments, 0.2% KMS was found as the best treatment for retaining powder recovery, reducing sugars, total sugars, ascorbic acid content, water activity, microbial count, dehydration ratio, rehydration ratio, texture and overall acceptability and 2% CaCl2 was found as the best pretreatment for moisture content, lycopene content, pH, non-enzymatic browning and colour and 2% NaCl was found as the best pretreatment for maximum titrable acidity, flavour and taste. Mechanical drying method was the best for retaining all the quality parameters except non-reducing sugars and pH which were maximum in spray drying. Mechanical drying with 0.2% KMS was found as the best treatment for retention of powder recovery, reducing sugars, total sugars, ascorbic acid content, water activity, microbial count, dehydration ratio, rehydration ratio, texture and overall acceptability and mechanical drying with 2% CaCl2 was found as the best treatment for minimum moisture content, lycopene content, pH, non-enzymatic browning and colour. Mechanical drying with 2% NaCl was found as the best pretreatment for titrable acidity, flavour and taste.ThesisItem Unknown EFFECT OF PLANTING DATES ON GROWTH, FLOWER YIELD AND QUALITY IN DIFFERENT GENOTYPES OF GOMPHRENA (Gomphrena globosa L.)(COLLEGE OF HORTICULTURE VENKATARAMANNAGUDEM, W.G.Dist. – 534 101 ANDHRA PRADESH, 2019-08-25) LANKA THABITHA; Dr. T. SUSEELAThe present investigation entitled “Effect of planting dates on growth, flower yield and quality in different genotypes of gomphrena (Gomphrena globosa L.)” was conducted at College of Horticulture, Venkataramannagudem, West Godavari district of Andhra Pradesh during 2018-2019. The experiment was laid out in a Factorial Randomized Block Design (FRBD) replicated thrice comprising of 15 different treatment combinations which include two factors viz., the first factor consists of five levels of genotypes (Arabhavi Gomphrena Selection AGS-5, AGS-6, AGS-7, AGS-8 and AGS-10) and the second factor with 3 levels of planting dates (19th September, 19th October and 19th November). The results of the experiment showed significant differences among the planting dates, genotypes and their interactions on all parameters. Based on the results obtained from the experiment AGS-5 planted on September 19th found to be best treatment combination based on positive results recorded on vegetative parameters like plant height, number of branches per plant, plant spread, total chlorophyll content, girth of stem, leaf area per plant, dry weight per plant; physiological parameters like absolute growth rate, crop growth rate, relative growth rate, net assimilation rate, leaf area index, leaf area duration, specific leaf area and phenological stages like number of days taken for bud formation, number of days taken for flower head formation and flower quality parameters like flower head size. The same treatment combination was found best with respect to yield parameters like flower yield per plant, number of seeds per flower head, seed yield per plant, seed yield per plot and 1000 seed weight. Regarding postharvest aspect it could be concluded that microwave oven drying recorded minimum time for drying of flowers. It is recommended that gomphrena genotype AGS-5 planted at 19th September is considered to be the right time of planting under the existing coastal climatic conditions of Andhra Pradesh. Hence this practice can be popularized among the floriculture farmers for continuous production of flowers along with major flowers to generate income throughout the year.ThesisItem Unknown STUDIES ON ENDOPHYTIC MICROORGANISMS AND THEIR ANTAGONISTIC EFFECT ON SOIL BORNE PATHOGENS IN ACID LIME (Citrus aurantifolia Swingle)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA -516 105, YSR KADAPA DISTRICT ANDHRA PRADESH, 2019-07-08) G. RAZIA SULTHANA BEGUM; Dr. B. GOVINDA RAJULUA roving survey was conducted in total 16 fields belonging to four mandals of Nellore and Kadapa districts of Andhra Pradesh, to know the incidence of root rot diseases in acid lime orchards. The root rot disease incidence was found to be high in Rapur mandal (8 per cent) followed by Podalakur mandal (5.8 per cent) of Nellore district. The incidence of root rot diseases was low in Kadapa district (3.59 per cent) comparatively. Among all the root rots, dry root caused by Fusarium solani was the major problem for the decline of citrus in the surveyed areas and hence the work was continued on the dry- root rot causing pathogen. The dry root rot pathogen Fusarium solani was isolated from the infected roots, based on cultural and morphological characters, the pathogen was confirmed by National Centre for Fungal Taxonomy (NCFT) as Fusarium solani (9624.19). A total of 6 fungal (EFA 1-6) and 8 bacterial (EBA 1-8) endophytes were isolated from roots of healthy plants. Name of the author : G. RAZIA SULTHANA BEGUM Title of the thesis : Studies on endophytic microorganisms and their antagonistic effect on soil borne pathogens in acid lime. (Citrus aurantifolia Swingle). Degree to which it is submitted : M.Sc. (Horticulture) Faculty Major field : : HORTICULTURE PLANT PATHOLOGY Chairman of advisory committee : Dr. B. GOVINDA RAJULU University : Dr. Y.S.R. HORTICULTURALUNIVERSITY Year of submission : 2019 On further in vitro evaluation, EFA 4 (66.92%) and EBA 7 (63.42%) had shown antagonistic activity on Fusarium solani by dual culture method. The compatibility experiments were conducted with 7 fungicides for the effective endophytic antagonists and the results revealed that, the endophytic fungal antagonist, EFA 4 was almost compatible with mancozeb 75% at 0.1% and 0.2%, fosetyl Al 80% at 0.1% and 0.2%, mancozeb 64% + metalaxyl-M 4% at 0.1% and 0.2% and was completely incompatible with carbendazim 50%, copper oxychloride 50% and carboxin 37.5% + thiram 37.5%. The endophytic bacterial antagonist, EBA 7 was compatible with almost all the tested fungicides. The effective endophytic antagonists were further characterized at molecular level. The fungal and bacterial antagonists, EFA 4 and EBA 7, was identified as Aspergillus fumigatus and Pseudomonas aeruginosa. A phylogenetic tree was constructed for the identified endophytic antagonists to find homology with other relevant species.ThesisItem Unknown EFFECT OF ORGANIC INPUTS ON GROWTH, FLOWER YIELD, POSTHARVEST TREATMENTS ON CAROTENE CONTENT AND PACKAGING MATERIAL ON SHELF LIFE OF AFRICAN MARIGOLD (Tagetes erecta L.)(COLLEGE OF HORTICULTURE, ANANTHARAJUPETA, Y.S.R. KADAPA Dist.- 516105 ANDHRA PRADESH, 2019-06-08) NALLAGOTI SUMANA; Dr. KODE SWARAJYA LAKSHMIThe study on “Effect of organic inputs on growth, flower yield, post harvest treatments on carotene content and packaging material on shelf life of African marigold (Tagetes erecta L.)ˮ was conducted during the year 2018-19 at College of Horticulture, Anantharajupeta, Y.S.R. Kadapa district of Andhra Pradesh. In first experiment, field investigation was done to study the effect of organic manures along with biofertilizer mixture (Azospirillum, PSB and Frateuria auratia). The experiment was laid out in Randomized Block Design (RBD) keeping seven treatments with three replications. Observations were recorded on vegetative, floral, quality and storage parameters. The observations on vegetative parameters revealed that, application of FYM + Biofertilizer mixture (T4) recorded maximum plant height (55.57 and 56.37 cm) at 60 DAT and 90 DAT, maximum number of branches (33.47) at 60 DAT, maximum stem girth (1.121 cm) at 60 DAT. Among floral parameters, application of FYM + Biofertilizer mixture (T4) took minimum number of days for first flower bud initiation (30.27), 50 % flowering (48.30), maximum duration of flowering (69.87), flowers per plant (53.07), flower diameter (7.30 cm), flower yield per plant (2.23 kg), flower yield per plot (24.69 kg), days taken to 50% flower wilt (3.33) and shelf life (6.67) . However, maximum flower weight (16.81g) was recorded in Vermicompost + Biofertilizer mixture (T5). During storage studies FYM + Biofertilizer mixture (T4) recorded less PLW % ranging from 9.02 – 33.82% from second day to eigth day, and carotene content ranging from 3.44 – 1.62 mg/g from the day of harvest to sixth day. In experiment II “Effect of different pretreatments on carotene content of African marigoldˮ the marigold flower petals were soaked in the pretreatment solution for 48 h at room temperature. In all the pretreatments flower petals to solution ratio was maintained at 1:1 weight to volume. After soaking, drying was done in cabinet drier at 45±20 C for 24 h. Enzyme mixture of cellulase, protease and xylanase at 0.2% (T1) recorded maximum (5.72 mg/g) carotene content. In experiment III “Effect of different packaging material on quality and shelf life of marigold flowers” LDPE (T6) of 200 guage recorded minimum PLW % ranging from 5.34 – 19.12 % from second day to eigth day, taken maximum number of days to 50% flower wilt (4.33) and shelf life (7.67). However, effect of different packaging material on carotene content of flowers found to be non-significant. Finally, it was concluded that the application of FYM along with biofertilizer mixture (T4) enchanced the vegetative, floral, quality and storage parameters under the tropical conditions of Rayalaseema region of Andhra Pradesh. Pretreatment of flower petals with enzymes mixture (cellulase, protease and xylanase) showed high carotene content. Among the packaging material studied LDPE covers maintained lower PLW percentage and maximum shelf life.