Loading...
Kerala Agricultural University, Thrissur
The history of agricultural education in Kerala can be traced back to the year 1896 when a scheme was evolved in the erstwhile Travancore State to train a few young men in scientific agriculture at the Demonstration Farm, Karamana, Thiruvananthapuram, presently, the Cropping Systems Research Centre under Kerala Agricultural University. Agriculture was introduced as an optional subject in the middle school classes in the State in 1922 when an Agricultural Middle School was started at Aluva, Ernakulam District. The popularity and usefulness of this school led to the starting of similar institutions at Kottarakkara and Konni in 1928 and 1931 respectively.
Agriculture was later introduced as an optional subject for Intermediate Course in 1953. In 1955, the erstwhile Government of Travancore-Cochin started the Agricultural College and Research Institute at Vellayani, Thiruvananthapuram and the College of Veterinary and Animal Sciences at Mannuthy, Thrissur for imparting higher education in agricultural and veterinary sciences, respectively. These institutions were brought under the direct administrative control of the Department of Agriculture and the Department of Animal Husbandry, respectively. With the formation of Kerala State in 1956, these two colleges were affiliated to the University of Kerala. The post-graduate programmes leading to M.Sc. (Ag), M.V.Sc. and Ph.D. degrees were started in 1961, 1962 and 1965 respectively.
On the recommendation of the Second National Education Commission (1964-66) headed by Dr. D.S. Kothari, the then Chairman of the University Grants Commission, one Agricultural University in each State was established. The State Agricultural Universities (SAUs) were established in India as an integral part of the National Agricultural Research System to give the much needed impetus to Agriculture Education and Research in the Country. As a result the Kerala Agricultural University (KAU) was established on 24th February 1971 by virtue of the Act 33 of 1971 and started functioning on 1st February 1972. The Kerala Agricultural University is the 15th in the series of the SAUs.
In accordance with the provisions of KAU Act of 1971, the Agricultural College and Research Institute at Vellayani, and the College of Veterinary and Animal Sciences, Mannuthy, were brought under the Kerala Agricultural University. In addition, twenty one agricultural and animal husbandry research stations were also transferred to the KAU for taking up research and extension programmes on various crops, animals, birds, etc.
During 2011, Kerala Agricultural University was trifurcated into Kerala Veterinary and Animal Sciences University (KVASU), Kerala University of Fisheries and Ocean Studies (KUFOS) and Kerala Agricultural University (KAU).
Now the University has seven colleges (four Agriculture, one Agricultural Engineering, one Forestry, one Co-operation Banking & Management), six RARSs, seven KVKs, 15 Research Stations and 16 Research and Extension Units under the faculties of Agriculture, Agricultural Engineering and Forestry. In addition, one Academy on Climate Change Adaptation and one Institute of Agricultural Technology offering M.Sc. (Integrated) Climate Change Adaptation and Diploma in Agricultural Sciences respectively are also functioning in Kerala Agricultural University.
Browse
5 results
Search Results
ThesisItem Open Access Evaluation of native isolates of nematode antagonistic fungi against meloidogyne incognita(Kofoid and White) chitwood in tomato(Department of Nematology, College of Agriculture, Vellayani, 2020) Jithoop, D; KAU; Narayana, RAn investigation entitled “Evaluation of native isolates of nematode antagonistic fungi against Meloidogyne incognita (Kofoid and White) Chitwood in tomato” was carried out at Department of Nematology, College of Agriculture, Vellayani during 2017-2019. The objective was to get native isolates of nematode antagonistic fungi and evaluate its bio-control potential against Meloidogyne incognita and growth promotion. A survey was conducted in six Taluks of Thiruvananthapuram districts during 2017-18 for isolation of indigenous fungi. Twenty soil and root samples were collected from the rhizosphere of vegetable crops like bhindi, tomato, chilly, cucumber and cowpea grown in each taluk by random sampling. Preliminary screening of 32 fungal colonies showing characteristics similar to Trichoderma (colonies with green, cottony white mycelium) and Purpureocillium (colonies powdery or suede-like, gold, green-gold, yellow-brown, lilac or tan) were selected and brought to pure culture by sub culturing technique. Thirty-two fungal isolates were subjected to preliminary screening under invitro conditions for testing its efficacy to bring about J2 mortality at standard concentration (100%). Among them ten isolates showed more than 50.00 per cent mortality of M. incognita juveniles were selected for further studies. Morphological and cultural characteristics of ten isolates were studied. Bio efficacy study of ten isolates against J2 mortality of M. incognita revealed that three isolates at lowest concentration (25%) showed 24.25, 34.00 and 34.50 per cent mortality of M. incognita juveniles 72 hrs after exposure. Isolate 10, 12, and 27 showed 85.05, 76.50 and 62.50 per cent mortality of M. incognita juveniles at 100 per cent concentration, 72 hr after treatment. CFEs of these three isolates were screened for ovicidal effects against M. incognita in vitro. Sterile water and plain broth were maintained as control. Results of the in vitro screening studies revealed that CFE of isolate 10 (100% concentration) was effective in inhibiting the egg hatching at three to eight days after treatment (14.00 to 23.00 per cent). Isolate 10 at 100% concentration was effective in increasing the mortality of M. incognita juveniles at 24, 48 and 72 hr after treatment (17.93 to 85.05 per cent). Based on ovicidal properties of CFE, three isolates were selected for pot culture experiment to find out the efficacy in comparison with Cartap hydrochloride and P. indica. The results revealed that soil drenching of isolate 10 1%(w/v) with RKN inoculation was effective in reducing the nematode population in soil (83.88 per cent) and root (75.91 per cent) and it was significantly superior to isolate 12 and isolate 27. The lowest number of nematodes were reported by isolate 10 (76.43). Lowest number of galls were reported by the soil drenching of isolate 10 (79.48 per cent). Efficacy of isolate 10 was found to be statistically on par with Cartap hydrochloride and P. indica in reducing the number of females and it also recorded the lowest number of egg masses. Isolate 10 was significantly superior to all other treatments in improving the growth parameters like plant height (86.05), fresh shoot weight (204.88), fresh root weight (81.00) compared to control plant height (59.50), fresh shoot weight (109.25), fresh root weight (48.50) respectively. Significantly superior yield was also recorded by Isolate 10 both with and without RKN inoculation. Morphological, Cultural and Molecular characterization of the fungal isolates were done for identification of isolates. Internal transcribed regions of DNA of ITS regions were amplified by ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) regions. Blast search of amplified DNA in NCBI data revealed the identity of isolate 10, 12 and 27 as Trichoderma viride and Metarhizium anisopliae and Fusarium verticillioides respectively. Results revealed that these three isolates suppressed population of M. incognita and increased growth and yield in tomato plants. Soil drenching of this indigenous fungal isolates 1% (w/v) can be recommended to manage M. incognita in tomato without any detrimental effect on environment.ThesisItem Open Access Management of root knot nematode, Meloidogyne incognita(Kofoid and white) chitwood in vegetable cowpea(Department of Nematology, College of Agriculture, Vellayani, 2020) Divya, T S; KAU; Nisha, M SThe study entitled 'Management of root-knot nematode, "'Meloidogyne incognita (Kofoid and White) Chitwood in vegetable cowpea" was conducted at Department of Nematology, College of Agriculture, Vellayani, Thiruvananthapuram during 2018-2020. The objectives were to screen varieties for resistance and to evaluate efficacy of biocontrol agents, organic amendment and new nematicide fluopyram for the management of root-knot nematode in vegetable cowpea. Seven varieties of vegetable cowpea (5 KAU released and 2 local) were screened for their resistance against Meloidogyne ineognita in pot culture under glass house condition. Tie experiment was laid out in CRD with 7 treatments and 3 replications. The results levealed that local variety collected flxrm Kadakkal was highly resistant to root-knot nematode with root-knot index 1. The local variety performed best in reducing the multiplication of nematodes. Lowest number of egg masses 5g roof'( 2.33), eggs egg mass' ( 63.33) and nematode population 200cc soil' (7 33) was observed in the local variety and it showed statistically significant variation compared to the KAU released varieties. Regarding the number of nodules 5g roof' also the Kadakkal variety showed significant superiority (22.67 nodules 5g roof') KAU variety VS 50 was highly susceptible to M. incogniia mfestatron w.th root-knot index 5. Highest number of egg masses 5g roof'(224.33) and number eggs egg mass"' (147.00) was recorded in VS 50. pot culture experiment was laid out in completely randomized design to stanHda rHdi zzle tthhe dosJage of fluopyram for the m^an ageme^nt. o f K ^incogniu. m cowpea. THe treatme^s w ^ ^ fluopyram 400 @ ^ ^ ,^S Og a., ha first treatment, flu ^ 250g a.i ha' as basal application, 25 days after first ^ J^s soil drenching to the root untreated. All .e --7-:^;:::::L,yram 400 SC @ 250g a.i ha ' knot nematode infected so . ^ ^ ^ was the effective dosage or . ^ y of the treatments. Nematode Phytotoxicity symptoms were not observed any penetration in roots and life eyele completion was obser\'ed in untreated control plants. M. inco^niui juveniles, adult female and male were not observed in roots of fluopyram treated cowpea plants. Galls and egg masses were observed in uprooted cowpea plant roots in untreated whereas in fluopyram applied treatments it was zero. Regarding final nematode population also, no nematodes were observed in soil samples were collected from fluopyram treated plants while in untreated control plants it was 761.5. Number of rhizobium nodules was significantly lower in untreated plants (17.75) while in fluopyram treated plants it ranged from 24.25 to 27.5 in 5g roots of cowpea plants. Field experiment was conducted by using the susceptible variety (VS 50) to stiidy the comparative effect of bio agents (Purpiireocillium lilacinum) and organic amendment (neem cake) in comparison with chemicals fluopyram and carbosulfan. The experiment was laid out in RED with 8 treatments and 3 replications. All the treatments significantly reduced nematode population in soil and root compared to untreated control. Effect of soil application of P. lilacinum (cfu 2x10*' g"') @ 10 g ^ cake @ 50 g m'^ found equally effective to basal application fluopyram 400 SC @ 250g a.i ha"' in reducing the nematode population in soil (93.03 per cent reduction over untreated) and root (86.94 per cent reduction over untreated). Regarding yield also effect of these two treatments was statistically on par giving 53 70 to 54.63 per cent increase over untreated. Plants treated with P. lilacinum (cfti 2x10^ g"') @ 10 g + neem cake @ 50 g m"^ showed significant superiority in number of nodules (29.33) in root (5g). Results on reisolation of bioagents at the time of harvest revealed that addition of organic substrate neemcake increased the persistence of bioagent (8.33x10^ cfn g soif') in soil. Residue of fluopyram and carbosulfan was found to be less than limit of quantification (LOQ) m cowpea pods, which were safe for consumption. From this study, it is concluded that vegetable cowpea variety Kadakkal local is resistant to M. incognita. Soil application off. lilacinum (cfu 2x106 g-1) @ 10 g + neem cake @ 50 g m'^ can be recommended for management of M. incognita in organic cultivation of cowpea.ThesisItem Open Access Management of reniform nematode Rotylenchulus reniformis linford and oliveira in vegetable cowpea using bacterial antagonists(Department of Nematology, College of Agriculture, Vellayani, 2020) Swathi Karthika, K S; KAU; Nisha, M SThe research entitled “Management of reniform nematode, Rotylenchulus reniformis Linford and Oliveira in vegetable cowpea using bacterial antagonists” was under taken in the Department of Nematology, College of Agriculture Vellayani, during 2018-2020. The objective was to isolate indigenous bacterial antagonists and to evaluate their biocontrol potential against R. reniformis in vegetable cowpea. A random sampling was done during 2018-19 in the cowpea grown fields of Aryanad, Athiyannur, Balaramapuram, Kalliyoor, Madavoor, Nemom, Neyyattinkara, Ottasekharamangalam, Ottoor, Vellanad, Vellayani and Venganoor areas of Thiruvananthapuram district. A total of sixty six soil and root samples were collected from rhizosphere of vegetable cowpea for isolation of indigenous bacterial antagonists against reniform nematode by serial dilution technique. The bacterial colonies having characters similar to Bacillus and Pseudomonas were made into pure culture by streak plate method. Cell free extracts (CFE) of forty five bacterial isolates obtained from soil, root and egg masses of R. reniformis were screened for juvenile mortality against R. reniformis and isolates which showed more than 50 per cent juvenile mortality were selected for preliminary screening under in vitro condition. CFE of twenty bacterial isolates at 100% concentration showed 50.50 to 100.00 per cent juvenile mortality 24 hours after treatment (HAT). The morphological and cultural characteristics and colony forming units of the twenty isolates were studied. CFE of four isolates (Isolate 26, 28, 25 and 11) at lowest concentration (25%) showed 65.50 to 73.50 per cent mortality of R. reniformis juveniles at 24 HAT while at highest concentration (100%) it was 98.50 to 100.00 per cent. The selected bacterial isolates were tested for effect on egg hatching and juvenile mortality of R. reniformis. Experiment was laid out in CRD with 100, 50, 33.3 and 25% concentration of four selected isolates, plain broth and sterile distilled water as treatments and four replications. Isolate 26, 28, 25 and 11 at 100% concentration recorded 3.33, 8.96, 11.67, 8.12 per cent egg hatching respectively at 7 days after treatment which was significantly superior to plain broth (93.96) and sterile distilled (94.17). CFE of Isolate 26, 28, 25 and 11 at 100% recorded 100, 100, 98.5 and 99.5 per cent juvenile mortality respectively 24 HAT and it was statistically on par. CFE of Isolate 26 at 100% concentration recorded 95.50 per cent juvenile mortality at 12 HAT. The four best isolates were tested for pathogenic reaction towards cowpea plant and none of them were pathogenic. Pot culture study was laid out in CRD to find out the biocontrol potential of the four isolates on R. reniformis in vegetable cowpea with five treatments and four replications. Effect of the four indigenous isolates were significantly superior to the untreated in reducing the nematode population in soil (87.35 to 91.45 per cent reduction over untreated) and number of egg masses in root (56.25 to 89.06 per cent reduction over untreated). The reproduction factor was also found reduced by the bacterial isolate application. The reproduction factor recorded by isolate 26, 28, 25 and 11 was 0.21, 0.27, 0.30 and 0.24 respectively while in control it was 2.41. The molecular characterization was done for identification of the bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of bacterial isolates were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. The blast search of amplified DNA in NCBI data revealed the identity of bacterial isolates. The Isolate 26, 28, 25 and 11 were identified as Lysinibacillus capsici strain NSK-KAU, Bacillus paramycoides strain NSK-KAU, Bacillus thuringiensis strain NSK-KAU, and Bacillus sp. strain NSK-KAU respectively. L. capsici, B. paramycoides, B. thuringiensis and Bacillus sp. showed high egg hatch inhibition and juvenile mortality under in vitro condition and low reproduction factor and egg masses under in vivo condition. This was reported first time from Kerala. From this study, it could be concluded that these bacterial antagonists can be exploited as successful biocontrol agents for the management of reniform nematode in cowpea.ThesisItem Open Access Pathogenicity of indigenous entomopathogenic nematodes against select insect pests(Department of Nematology, College of Agriculture, Vellayani, 2019) Sooraj, S; KAU; Nisha, MAn investigation entitled “Pathogenicity of indigenous entomopathogenic nematodes against select insect pests” was carried out at the Department of Nematology, College of Agriculture, Vellayani during 2017-19. The main objectives were to identify indigenous entomopathogenic nematodes and evaluate their pathogenicity to termites, lepidopteran and coleopteran pests. Survey was conducted in Thiruvanathapuram, Kollam, Pathanamthitta and Alappuzha districts during 2017-18 and a total of forty soil samples were collected from the rhizosphere of vegetables, banana and coconut by random sampling. Entomopathogenic nematodes (EPN) were isolated from soil using Corcyra cephalonica larvae by insect trap method. EPN from insect cadavers were extracted by white trap method. From forty soil samples collected, three species of EPN were isolated and their morphological characters were studied. The infectivity of native EPN strains were assessed at an inoculum level of 300 IJs/insect against test insects viz. termites, aphids, tobacco caterpillar and pseudostem weevil under in vitro condition. Among the isolates, isolate obtained from Mylom area in Kottarakkara (Isolate 2) showed maximum emergence of Infective Juveniles (IJs) from termites (2.0x103 IJs/adult), aphids (1.2x103 IJs/adult), tobacco caterpillar (3.5x105 IJs/larvae) and pseudostem weevil (3.5x105 IJs/grub). Isolate 2 also showed mortality percentage of 87.99, 86.00, 29.99 and 9.99 against termite, aphids, tobacco caterpillar and pseudostem weevil respectively at 24 hours after treatment. Isolate obtained from College of Agriculture, Vellayani (Isolate 1) and Isolate obtained from Kainidi area in Alappuzha (Isolate 3) showed mortality of 86.00 and 76.00 per cent in termites and 81.74 and 71.99 per cent in aphids respectively. Infection of Isolate 2 resulted in brown, pink and reddish brown discolouration in cadavers of termites, tobacco caterpillar and pseudostem weevil respectively. Based on results of preliminary screening, Isolate 1, 2 and 3 were tested for their pathogenicity against test insects under in vitro condition. The experimental design used was CRD with treatments viz., 10, 50, 100, 200 IJs, sterile water and chemical check and were replicated four times. Isolate 1 and 2 @ 100 IJs caused cent per cent mortality of termites at 48 hours after treatment (HAT) and it was statistically on par with chlorpyriphos 25 EC. Isolate 3 @ 200 IJs showed cent percent mortality of termites at 60 HAT. Isolate 2 @ 200IJs recorded 99.26 per cent mortality of aphids at 36 HAT and it was statistically on par with chemical, dimethoate 30 EC. Isolate 2 @ 100 IJs recorded cent percent mortality of aphids at 48 HAT. In the case of tobacco caterpillar, Isolate 2 @ 200 IJs recorded 65.08 and 80.52 per cent mortality at 48 and 60 HAT respectively. Isolate 2 @ 100 IJs recorded 92.53 per cent mortality of tobacco caterpillar at 72 HAT and it was statistically on par with chemical, flubendiamide 39.35 EC. Isolate 2 @ 200 IJs showed 62.66 per cent mortality of pseudostem weevil grubs at 72 HAT. Among the three isolates, Isolate 2 is proved to be the most potent EPN strain with highest mortality in termites, aphids, tobacco caterpillar and pseudostem weevil. Based on the morphological characters, Isolate 1 was identified as Steinernema sp., Isolates 2 as Metarhabditis sp. and Isolate 3 as Rhabditis sp. The IJs of Steinernema sp. were specific in retaining the second stage cuticle. The adults were characterized by short stoma, excretory pore anterior to the nerve ring and a muscular oesophagous (female-154.00±5.57µm, male-144.40±4.14µm) without a well-defined butterfly valve in the basal bulb. The males had a C shaped body having pointed and curved spicules (44.10±4.46µm) with a boat shaped gubernaculum (23.70±2.98µm). The females had a sub median protruding vulva. The IJs of Rhabditis sp. had a narrow body without second stage cuticle. The adults of Rhabditis sp. had six unfused labium at the anterior region, long tubular stoma, excretory pore anterior to the basal bulb and a muscular oesophagous with a well-defined butterfly valve. Metarhabditis sp. (Isolate 2) had lobed oesophageal glands different from Rhabditis sp. (Isolate 3). The males of Metarhabditis sp. (Isolate 2) had a round manubrium in spicules (39.63±3.59µm) unlike males of Rhabditis sp. (Isolate 3) (33.83±4.36µm). Metarhabditis sp. (Isolate 2) was characterized by presence of peloderan bursa with eight papillae whereas Rhabditis sp. (Isolate 3) had leptoderan bursa with nine papillae. The male tail in Metarhabditis sp. (Isolate 2) (28.60±5.10µm) was straight and pointed whereas Rhabditis sp. (Isolate 3) had a ventrally curved tail (29.71±4.86µm). Vulva was characterized by slightly protruding vulval lips in females of Rhabditis sp. Based on the pathogenicity studies, Isolate 2 (Metarhabditis sp.) was identified as the most potent strain causing highest mortality in test insects. Hence molecular characterization of Isolate 2 was done and result revealed it as Metarhabditis rainai. This was the first report of M. rainai in India. From the above study it could be concluded that M. rainai can be exploited as a successful biocontrol agent pertaining to its pathogenicity against termites, lepidopteran and coleopteran pests and effort needs to be directed towards formulating the strain to improve its efficiency and shelf life.ThesisItem Open Access Exploitation of indigenous bacterial antagonists against root-knot nematode, meloidogyne incognita (kofoid and white ) chitwood(Department of Nematology, College off Agriculture, Vellayani, 2018) Vishnu, J S; KAU; Nisha, M SAn investigation entitled "Exploitation of indigenouos bacterial antagonists against root-knot nematode, Meloidogyne incognita (Kofoid and White)Chitwood" was carried out at department of nematology, college of agriculture, vellayani during 2016-2018. The objective was to isolate indigenous bacterial antagonists and to evaluate their bio control potential against root-knot nematode. A survey was conducted in three agro ecological units viz., high ranges in Idukki, midlands in Thrissur and low lands in Thiruvananthapuram districts during 2016-17 for isolation of indigenous bacteria. A total of sixty two soil and fifty eight root samples were collected from the rhizosphere of cardamon, pepper,rice and vegetables by randon sampling. Thirty eight bacterial colonies showing characteristics similar to Bacillus and Pseudomonas were selected and brought into pure culture by streak plate technique. Twelve isolates which showed 66.00 to 94.00 percent mortality of M. icognita juiveniles were selected after preliminary screening under in vitro condidtions. Morphological and cultural characteristics and colony forming units of twelve isolates were studied.. Bio efficacy study of twelve isolates on M. incognita juveniles revealed that four isaolates at lowest concentration (25%) showed 58.00 to 72.50 percent mortality of M. incognita juveniles 72 hr after exposure. Isolate 1,2,3 and 4 showed 91.00, 94.00,87.00 and 81.50 percent mortality of M. incognira juveniles at 100 percent concentration, 72 hr after treatment respectively. Cell free extracts of these four isolates were screened for ovicidal and larvicidal effects against M. incognita under in vitro. Sterile water and plain broth were maintained as control. Results of the in vitro screening studies revealed dthat cell free extract of isolate 1 amd 2 (100% concentration ) were effective in inhibiting the egg hatching at three to eight days after treatment (0.20 to 7.96 percent). These two isolates at (100% concentration ) also showed statistically significant superiority over all other isolates allowing only 4.65 to 7.96 per cent egg hatching compared to control on 6th, 7th and 8th day after treatment. Isolate 2 at 100% concentration was effective in increasing the mortality of M. incognita juveniles at 24, 48 and 72 hr after treatment (27.00 to 94.00 percent). Isolate 1 and Isoslate 2 (100% concentration) were found to be statistically on par in exhibiting 51.50 and 54.00 per cent juvenile mortality respectively after 48 hr of treatment. Based on larvicidal and ovicidal properties of cell free extracts, two isolates were selected for pot culture experiment to find out the efficacy in comparison with NBAIR isolate (Bacillus subtilis), organic amendment (neem cake) and chemical cartap hydrochloride). The results revealed that soil drenching with isolate 2 (1*10 7 cfu mL-1)@ 50 mL pot-1 was effective in reducing the nemotode population in soil (72.69 per cent) and root(82.33 per cent ) and it was significantly superior to B.subtilis, Isolate 1 and neem cake. Efficacy of Isolate 2 was found to be statistically on par with chemical, cartap hydrochloride in reducing the number of galls (73.92 to 75.64 percent and females (60.00 to 68.57 per cent ) in root. Isolate 2 was significantly superior to all other treatments in improving the growth parameters (fresh plant weight and root weight). Significantly superior yield was also recordede by isolate 1 and 2 in comparison with neem cake and B.subtilis. Biochemical and molecular characterization were done for identification of bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of Isolate 1 and 2 were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. Blast search of amplified DNA in NCBI data revealed the identity of Isolate 1 and Isolte 2 as Bacillus thuringiensis strain a57 and stenotrophomonas maltophilia strain W2-7 respectivelly. The identity of bacteria was further confirmed by biochemical analysis. The present study was successful in identifying two bacterial antagonists (Stenotrophomonas maltophilia strain W2-7 and Bacillus thuringiensis strain a57) against root-knot nematode. Results revealed that these two isolates suppressed population of M.incognita and increased growth and yield in tomato plants. Soil drenching with these two indigenous bacterial isolates (1*10 7 cuf ml-1)@ 50 mL pot-1can be recommended to manage M.incognita in tomato without any detrimental effect on environment.
