Thumbnail Image

Kerala Agricultural University, Thrissur

The history of agricultural education in Kerala can be traced back to the year 1896 when a scheme was evolved in the erstwhile Travancore State to train a few young men in scientific agriculture at the Demonstration Farm, Karamana, Thiruvananthapuram, presently, the Cropping Systems Research Centre under Kerala Agricultural University. Agriculture was introduced as an optional subject in the middle school classes in the State in 1922 when an Agricultural Middle School was started at Aluva, Ernakulam District. The popularity and usefulness of this school led to the starting of similar institutions at Kottarakkara and Konni in 1928 and 1931 respectively. Agriculture was later introduced as an optional subject for Intermediate Course in 1953. In 1955, the erstwhile Government of Travancore-Cochin started the Agricultural College and Research Institute at Vellayani, Thiruvananthapuram and the College of Veterinary and Animal Sciences at Mannuthy, Thrissur for imparting higher education in agricultural and veterinary sciences, respectively. These institutions were brought under the direct administrative control of the Department of Agriculture and the Department of Animal Husbandry, respectively. With the formation of Kerala State in 1956, these two colleges were affiliated to the University of Kerala. The post-graduate programmes leading to M.Sc. (Ag), M.V.Sc. and Ph.D. degrees were started in 1961, 1962 and 1965 respectively. On the recommendation of the Second National Education Commission (1964-66) headed by Dr. D.S. Kothari, the then Chairman of the University Grants Commission, one Agricultural University in each State was established. The State Agricultural Universities (SAUs) were established in India as an integral part of the National Agricultural Research System to give the much needed impetus to Agriculture Education and Research in the Country. As a result the Kerala Agricultural University (KAU) was established on 24th February 1971 by virtue of the Act 33 of 1971 and started functioning on 1st February 1972. The Kerala Agricultural University is the 15th in the series of the SAUs. In accordance with the provisions of KAU Act of 1971, the Agricultural College and Research Institute at Vellayani, and the College of Veterinary and Animal Sciences, Mannuthy, were brought under the Kerala Agricultural University. In addition, twenty one agricultural and animal husbandry research stations were also transferred to the KAU for taking up research and extension programmes on various crops, animals, birds, etc. During 2011, Kerala Agricultural University was trifurcated into Kerala Veterinary and Animal Sciences University (KVASU), Kerala University of Fisheries and Ocean Studies (KUFOS) and Kerala Agricultural University (KAU). Now the University has seven colleges (four Agriculture, one Agricultural Engineering, one Forestry, one Co-operation Banking & Management), six RARSs, seven KVKs, 15 Research Stations and 16 Research and Extension Units under the faculties of Agriculture, Agricultural Engineering and Forestry. In addition, one Academy on Climate Change Adaptation and one Institute of Agricultural Technology offering M.Sc. (Integrated) Climate Change Adaptation and Diploma in Agricultural Sciences respectively are also functioning in Kerala Agricultural University.

Browse

20203
Reset filters
Subject: Nematology × Author: KAU × End date: 2022 × Start date: 2020 × Type: Thesis ×
Reset filters

Search Results

Now showing 1 - 3 of 3
  • Thumbnail Image
    ThesisItemOpen Access
    Evaluation of native isolates of nematode antagonistic fungi against meloidogyne incognita(Kofoid and White) chitwood in tomato
    (Department of Nematology, College of Agriculture, Vellayani, 2020) Jithoop, D; KAU; Narayana, R
    An investigation entitled “Evaluation of native isolates of nematode antagonistic fungi against Meloidogyne incognita (Kofoid and White) Chitwood in tomato” was carried out at Department of Nematology, College of Agriculture, Vellayani during 2017-2019. The objective was to get native isolates of nematode antagonistic fungi and evaluate its bio-control potential against Meloidogyne incognita and growth promotion. A survey was conducted in six Taluks of Thiruvananthapuram districts during 2017-18 for isolation of indigenous fungi. Twenty soil and root samples were collected from the rhizosphere of vegetable crops like bhindi, tomato, chilly, cucumber and cowpea grown in each taluk by random sampling. Preliminary screening of 32 fungal colonies showing characteristics similar to Trichoderma (colonies with green, cottony white mycelium) and Purpureocillium (colonies powdery or suede-like, gold, green-gold, yellow-brown, lilac or tan) were selected and brought to pure culture by sub culturing technique. Thirty-two fungal isolates were subjected to preliminary screening under invitro conditions for testing its efficacy to bring about J2 mortality at standard concentration (100%). Among them ten isolates showed more than 50.00 per cent mortality of M. incognita juveniles were selected for further studies. Morphological and cultural characteristics of ten isolates were studied. Bio efficacy study of ten isolates against J2 mortality of M. incognita revealed that three isolates at lowest concentration (25%) showed 24.25, 34.00 and 34.50 per cent mortality of M. incognita juveniles 72 hrs after exposure. Isolate 10, 12, and 27 showed 85.05, 76.50 and 62.50 per cent mortality of M. incognita juveniles at 100 per cent concentration, 72 hr after treatment. CFEs of these three isolates were screened for ovicidal effects against M. incognita in vitro. Sterile water and plain broth were maintained as control. Results of the in vitro screening studies revealed that CFE of isolate 10 (100% concentration) was effective in inhibiting the egg hatching at three to eight days after treatment (14.00 to 23.00 per cent). Isolate 10 at 100% concentration was effective in increasing the mortality of M. incognita juveniles at 24, 48 and 72 hr after treatment (17.93 to 85.05 per cent). Based on ovicidal properties of CFE, three isolates were selected for pot culture experiment to find out the efficacy in comparison with Cartap hydrochloride and P. indica. The results revealed that soil drenching of isolate 10 1%(w/v) with RKN inoculation was effective in reducing the nematode population in soil (83.88 per cent) and root (75.91 per cent) and it was significantly superior to isolate 12 and isolate 27. The lowest number of nematodes were reported by isolate 10 (76.43). Lowest number of galls were reported by the soil drenching of isolate 10 (79.48 per cent). Efficacy of isolate 10 was found to be statistically on par with Cartap hydrochloride and P. indica in reducing the number of females and it also recorded the lowest number of egg masses. Isolate 10 was significantly superior to all other treatments in improving the growth parameters like plant height (86.05), fresh shoot weight (204.88), fresh root weight (81.00) compared to control plant height (59.50), fresh shoot weight (109.25), fresh root weight (48.50) respectively. Significantly superior yield was also recorded by Isolate 10 both with and without RKN inoculation. Morphological, Cultural and Molecular characterization of the fungal isolates were done for identification of isolates. Internal transcribed regions of DNA of ITS regions were amplified by ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) regions. Blast search of amplified DNA in NCBI data revealed the identity of isolate 10, 12 and 27 as Trichoderma viride and Metarhizium anisopliae and Fusarium verticillioides respectively. Results revealed that these three isolates suppressed population of M. incognita and increased growth and yield in tomato plants. Soil drenching of this indigenous fungal isolates 1% (w/v) can be recommended to manage M. incognita in tomato without any detrimental effect on environment.
  • Thumbnail Image
    ThesisItemOpen Access
    Management of root knot nematode, Meloidogyne incognita(Kofoid and white) chitwood in vegetable cowpea
    (Department of Nematology, College of Agriculture, Vellayani, 2020) Divya, T S; KAU; Nisha, M S
    The study entitled 'Management of root-knot nematode, "'Meloidogyne incognita (Kofoid and White) Chitwood in vegetable cowpea" was conducted at Department of Nematology, College of Agriculture, Vellayani, Thiruvananthapuram during 2018-2020. The objectives were to screen varieties for resistance and to evaluate efficacy of biocontrol agents, organic amendment and new nematicide fluopyram for the management of root-knot nematode in vegetable cowpea. Seven varieties of vegetable cowpea (5 KAU released and 2 local) were screened for their resistance against Meloidogyne ineognita in pot culture under glass house condition. Tie experiment was laid out in CRD with 7 treatments and 3 replications. The results levealed that local variety collected flxrm Kadakkal was highly resistant to root-knot nematode with root-knot index 1. The local variety performed best in reducing the multiplication of nematodes. Lowest number of egg masses 5g roof'( 2.33), eggs egg mass' ( 63.33) and nematode population 200cc soil' (7 33) was observed in the local variety and it showed statistically significant variation compared to the KAU released varieties. Regarding the number of nodules 5g roof' also the Kadakkal variety showed significant superiority (22.67 nodules 5g roof') KAU variety VS 50 was highly susceptible to M. incogniia mfestatron w.th root-knot index 5. Highest number of egg masses 5g roof'(224.33) and number eggs egg mass"' (147.00) was recorded in VS 50. pot culture experiment was laid out in completely randomized design to stanHda rHdi zzle tthhe dosJage of fluopyram for the m^an ageme^nt. o f K ^incogniu. m cowpea. THe treatme^s w ^ ^ fluopyram 400 @ ^ ^ ,^S Og a., ha first treatment, flu ^ 250g a.i ha' as basal application, 25 days after first ^ J^s soil drenching to the root untreated. All .e --7-:^;:::::L,yram 400 SC @ 250g a.i ha ' knot nematode infected so . ^ ^ ^ was the effective dosage or . ^ y of the treatments. Nematode Phytotoxicity symptoms were not observed any penetration in roots and life eyele completion was obser\'ed in untreated control plants. M. inco^niui juveniles, adult female and male were not observed in roots of fluopyram treated cowpea plants. Galls and egg masses were observed in uprooted cowpea plant roots in untreated whereas in fluopyram applied treatments it was zero. Regarding final nematode population also, no nematodes were observed in soil samples were collected from fluopyram treated plants while in untreated control plants it was 761.5. Number of rhizobium nodules was significantly lower in untreated plants (17.75) while in fluopyram treated plants it ranged from 24.25 to 27.5 in 5g roots of cowpea plants. Field experiment was conducted by using the susceptible variety (VS 50) to stiidy the comparative effect of bio agents (Purpiireocillium lilacinum) and organic amendment (neem cake) in comparison with chemicals fluopyram and carbosulfan. The experiment was laid out in RED with 8 treatments and 3 replications. All the treatments significantly reduced nematode population in soil and root compared to untreated control. Effect of soil application of P. lilacinum (cfu 2x10*' g"') @ 10 g ^ cake @ 50 g m'^ found equally effective to basal application fluopyram 400 SC @ 250g a.i ha"' in reducing the nematode population in soil (93.03 per cent reduction over untreated) and root (86.94 per cent reduction over untreated). Regarding yield also effect of these two treatments was statistically on par giving 53 70 to 54.63 per cent increase over untreated. Plants treated with P. lilacinum (cfti 2x10^ g"') @ 10 g + neem cake @ 50 g m"^ showed significant superiority in number of nodules (29.33) in root (5g). Results on reisolation of bioagents at the time of harvest revealed that addition of organic substrate neemcake increased the persistence of bioagent (8.33x10^ cfn g soif') in soil. Residue of fluopyram and carbosulfan was found to be less than limit of quantification (LOQ) m cowpea pods, which were safe for consumption. From this study, it is concluded that vegetable cowpea variety Kadakkal local is resistant to M. incognita. Soil application off. lilacinum (cfu 2x106 g-1) @ 10 g + neem cake @ 50 g m'^ can be recommended for management of M. incognita in organic cultivation of cowpea.
  • Thumbnail Image
    ThesisItemOpen Access
    Management of reniform nematode Rotylenchulus reniformis linford and oliveira in vegetable cowpea using bacterial antagonists
    (Department of Nematology, College of Agriculture, Vellayani, 2020) Swathi Karthika, K S; KAU; Nisha, M S
    The research entitled “Management of reniform nematode, Rotylenchulus reniformis Linford and Oliveira in vegetable cowpea using bacterial antagonists” was under taken in the Department of Nematology, College of Agriculture Vellayani, during 2018-2020. The objective was to isolate indigenous bacterial antagonists and to evaluate their biocontrol potential against R. reniformis in vegetable cowpea. A random sampling was done during 2018-19 in the cowpea grown fields of Aryanad, Athiyannur, Balaramapuram, Kalliyoor, Madavoor, Nemom, Neyyattinkara, Ottasekharamangalam, Ottoor, Vellanad, Vellayani and Venganoor areas of Thiruvananthapuram district. A total of sixty six soil and root samples were collected from rhizosphere of vegetable cowpea for isolation of indigenous bacterial antagonists against reniform nematode by serial dilution technique. The bacterial colonies having characters similar to Bacillus and Pseudomonas were made into pure culture by streak plate method. Cell free extracts (CFE) of forty five bacterial isolates obtained from soil, root and egg masses of R. reniformis were screened for juvenile mortality against R. reniformis and isolates which showed more than 50 per cent juvenile mortality were selected for preliminary screening under in vitro condition. CFE of twenty bacterial isolates at 100% concentration showed 50.50 to 100.00 per cent juvenile mortality 24 hours after treatment (HAT). The morphological and cultural characteristics and colony forming units of the twenty isolates were studied. CFE of four isolates (Isolate 26, 28, 25 and 11) at lowest concentration (25%) showed 65.50 to 73.50 per cent mortality of R. reniformis juveniles at 24 HAT while at highest concentration (100%) it was 98.50 to 100.00 per cent. The selected bacterial isolates were tested for effect on egg hatching and juvenile mortality of R. reniformis. Experiment was laid out in CRD with 100, 50, 33.3 and 25% concentration of four selected isolates, plain broth and sterile distilled water as treatments and four replications. Isolate 26, 28, 25 and 11 at 100% concentration recorded 3.33, 8.96, 11.67, 8.12 per cent egg hatching respectively at 7 days after treatment which was significantly superior to plain broth (93.96) and sterile distilled (94.17). CFE of Isolate 26, 28, 25 and 11 at 100% recorded 100, 100, 98.5 and 99.5 per cent juvenile mortality respectively 24 HAT and it was statistically on par. CFE of Isolate 26 at 100% concentration recorded 95.50 per cent juvenile mortality at 12 HAT. The four best isolates were tested for pathogenic reaction towards cowpea plant and none of them were pathogenic. Pot culture study was laid out in CRD to find out the biocontrol potential of the four isolates on R. reniformis in vegetable cowpea with five treatments and four replications. Effect of the four indigenous isolates were significantly superior to the untreated in reducing the nematode population in soil (87.35 to 91.45 per cent reduction over untreated) and number of egg masses in root (56.25 to 89.06 per cent reduction over untreated). The reproduction factor was also found reduced by the bacterial isolate application. The reproduction factor recorded by isolate 26, 28, 25 and 11 was 0.21, 0.27, 0.30 and 0.24 respectively while in control it was 2.41. The molecular characterization was done for identification of the bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of bacterial isolates were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. The blast search of amplified DNA in NCBI data revealed the identity of bacterial isolates. The Isolate 26, 28, 25 and 11 were identified as Lysinibacillus capsici strain NSK-KAU, Bacillus paramycoides strain NSK-KAU, Bacillus thuringiensis strain NSK-KAU, and Bacillus sp. strain NSK-KAU respectively. L. capsici, B. paramycoides, B. thuringiensis and Bacillus sp. showed high egg hatch inhibition and juvenile mortality under in vitro condition and low reproduction factor and egg masses under in vivo condition. This was reported first time from Kerala. From this study, it could be concluded that these bacterial antagonists can be exploited as successful biocontrol agents for the management of reniform nematode in cowpea.