Thumbnail Image

Kerala Agricultural University, Thrissur

The history of agricultural education in Kerala can be traced back to the year 1896 when a scheme was evolved in the erstwhile Travancore State to train a few young men in scientific agriculture at the Demonstration Farm, Karamana, Thiruvananthapuram, presently, the Cropping Systems Research Centre under Kerala Agricultural University. Agriculture was introduced as an optional subject in the middle school classes in the State in 1922 when an Agricultural Middle School was started at Aluva, Ernakulam District. The popularity and usefulness of this school led to the starting of similar institutions at Kottarakkara and Konni in 1928 and 1931 respectively. Agriculture was later introduced as an optional subject for Intermediate Course in 1953. In 1955, the erstwhile Government of Travancore-Cochin started the Agricultural College and Research Institute at Vellayani, Thiruvananthapuram and the College of Veterinary and Animal Sciences at Mannuthy, Thrissur for imparting higher education in agricultural and veterinary sciences, respectively. These institutions were brought under the direct administrative control of the Department of Agriculture and the Department of Animal Husbandry, respectively. With the formation of Kerala State in 1956, these two colleges were affiliated to the University of Kerala. The post-graduate programmes leading to M.Sc. (Ag), M.V.Sc. and Ph.D. degrees were started in 1961, 1962 and 1965 respectively. On the recommendation of the Second National Education Commission (1964-66) headed by Dr. D.S. Kothari, the then Chairman of the University Grants Commission, one Agricultural University in each State was established. The State Agricultural Universities (SAUs) were established in India as an integral part of the National Agricultural Research System to give the much needed impetus to Agriculture Education and Research in the Country. As a result the Kerala Agricultural University (KAU) was established on 24th February 1971 by virtue of the Act 33 of 1971 and started functioning on 1st February 1972. The Kerala Agricultural University is the 15th in the series of the SAUs. In accordance with the provisions of KAU Act of 1971, the Agricultural College and Research Institute at Vellayani, and the College of Veterinary and Animal Sciences, Mannuthy, were brought under the Kerala Agricultural University. In addition, twenty one agricultural and animal husbandry research stations were also transferred to the KAU for taking up research and extension programmes on various crops, animals, birds, etc. During 2011, Kerala Agricultural University was trifurcated into Kerala Veterinary and Animal Sciences University (KVASU), Kerala University of Fisheries and Ocean Studies (KUFOS) and Kerala Agricultural University (KAU). Now the University has seven colleges (four Agriculture, one Agricultural Engineering, one Forestry, one Co-operation Banking & Management), six RARSs, seven KVKs, 15 Research Stations and 16 Research and Extension Units under the faculties of Agriculture, Agricultural Engineering and Forestry. In addition, one Academy on Climate Change Adaptation and one Institute of Agricultural Technology offering M.Sc. (Integrated) Climate Change Adaptation and Diploma in Agricultural Sciences respectively are also functioning in Kerala Agricultural University.

Browse

20201
Reset filters
Subject: Nematology × Author: KAU × Author: Swathi Karthika, K S × End date: 2020 × Start date: 2010 × Thesis Type: M.Sc ×
Reset filters

Search Results

Now showing 1 - 1 of 1
  • Thumbnail Image
    ThesisItemOpen Access
    Management of reniform nematode Rotylenchulus reniformis linford and oliveira in vegetable cowpea using bacterial antagonists
    (Department of Nematology, College of Agriculture, Vellayani, 2020) Swathi Karthika, K S; KAU; Nisha, M S
    The research entitled “Management of reniform nematode, Rotylenchulus reniformis Linford and Oliveira in vegetable cowpea using bacterial antagonists” was under taken in the Department of Nematology, College of Agriculture Vellayani, during 2018-2020. The objective was to isolate indigenous bacterial antagonists and to evaluate their biocontrol potential against R. reniformis in vegetable cowpea. A random sampling was done during 2018-19 in the cowpea grown fields of Aryanad, Athiyannur, Balaramapuram, Kalliyoor, Madavoor, Nemom, Neyyattinkara, Ottasekharamangalam, Ottoor, Vellanad, Vellayani and Venganoor areas of Thiruvananthapuram district. A total of sixty six soil and root samples were collected from rhizosphere of vegetable cowpea for isolation of indigenous bacterial antagonists against reniform nematode by serial dilution technique. The bacterial colonies having characters similar to Bacillus and Pseudomonas were made into pure culture by streak plate method. Cell free extracts (CFE) of forty five bacterial isolates obtained from soil, root and egg masses of R. reniformis were screened for juvenile mortality against R. reniformis and isolates which showed more than 50 per cent juvenile mortality were selected for preliminary screening under in vitro condition. CFE of twenty bacterial isolates at 100% concentration showed 50.50 to 100.00 per cent juvenile mortality 24 hours after treatment (HAT). The morphological and cultural characteristics and colony forming units of the twenty isolates were studied. CFE of four isolates (Isolate 26, 28, 25 and 11) at lowest concentration (25%) showed 65.50 to 73.50 per cent mortality of R. reniformis juveniles at 24 HAT while at highest concentration (100%) it was 98.50 to 100.00 per cent. The selected bacterial isolates were tested for effect on egg hatching and juvenile mortality of R. reniformis. Experiment was laid out in CRD with 100, 50, 33.3 and 25% concentration of four selected isolates, plain broth and sterile distilled water as treatments and four replications. Isolate 26, 28, 25 and 11 at 100% concentration recorded 3.33, 8.96, 11.67, 8.12 per cent egg hatching respectively at 7 days after treatment which was significantly superior to plain broth (93.96) and sterile distilled (94.17). CFE of Isolate 26, 28, 25 and 11 at 100% recorded 100, 100, 98.5 and 99.5 per cent juvenile mortality respectively 24 HAT and it was statistically on par. CFE of Isolate 26 at 100% concentration recorded 95.50 per cent juvenile mortality at 12 HAT. The four best isolates were tested for pathogenic reaction towards cowpea plant and none of them were pathogenic. Pot culture study was laid out in CRD to find out the biocontrol potential of the four isolates on R. reniformis in vegetable cowpea with five treatments and four replications. Effect of the four indigenous isolates were significantly superior to the untreated in reducing the nematode population in soil (87.35 to 91.45 per cent reduction over untreated) and number of egg masses in root (56.25 to 89.06 per cent reduction over untreated). The reproduction factor was also found reduced by the bacterial isolate application. The reproduction factor recorded by isolate 26, 28, 25 and 11 was 0.21, 0.27, 0.30 and 0.24 respectively while in control it was 2.41. The molecular characterization was done for identification of the bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of bacterial isolates were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. The blast search of amplified DNA in NCBI data revealed the identity of bacterial isolates. The Isolate 26, 28, 25 and 11 were identified as Lysinibacillus capsici strain NSK-KAU, Bacillus paramycoides strain NSK-KAU, Bacillus thuringiensis strain NSK-KAU, and Bacillus sp. strain NSK-KAU respectively. L. capsici, B. paramycoides, B. thuringiensis and Bacillus sp. showed high egg hatch inhibition and juvenile mortality under in vitro condition and low reproduction factor and egg masses under in vivo condition. This was reported first time from Kerala. From this study, it could be concluded that these bacterial antagonists can be exploited as successful biocontrol agents for the management of reniform nematode in cowpea.