Thumbnail Image

Kerala Agricultural University, Thrissur

The history of agricultural education in Kerala can be traced back to the year 1896 when a scheme was evolved in the erstwhile Travancore State to train a few young men in scientific agriculture at the Demonstration Farm, Karamana, Thiruvananthapuram, presently, the Cropping Systems Research Centre under Kerala Agricultural University. Agriculture was introduced as an optional subject in the middle school classes in the State in 1922 when an Agricultural Middle School was started at Aluva, Ernakulam District. The popularity and usefulness of this school led to the starting of similar institutions at Kottarakkara and Konni in 1928 and 1931 respectively. Agriculture was later introduced as an optional subject for Intermediate Course in 1953. In 1955, the erstwhile Government of Travancore-Cochin started the Agricultural College and Research Institute at Vellayani, Thiruvananthapuram and the College of Veterinary and Animal Sciences at Mannuthy, Thrissur for imparting higher education in agricultural and veterinary sciences, respectively. These institutions were brought under the direct administrative control of the Department of Agriculture and the Department of Animal Husbandry, respectively. With the formation of Kerala State in 1956, these two colleges were affiliated to the University of Kerala. The post-graduate programmes leading to M.Sc. (Ag), M.V.Sc. and Ph.D. degrees were started in 1961, 1962 and 1965 respectively. On the recommendation of the Second National Education Commission (1964-66) headed by Dr. D.S. Kothari, the then Chairman of the University Grants Commission, one Agricultural University in each State was established. The State Agricultural Universities (SAUs) were established in India as an integral part of the National Agricultural Research System to give the much needed impetus to Agriculture Education and Research in the Country. As a result the Kerala Agricultural University (KAU) was established on 24th February 1971 by virtue of the Act 33 of 1971 and started functioning on 1st February 1972. The Kerala Agricultural University is the 15th in the series of the SAUs. In accordance with the provisions of KAU Act of 1971, the Agricultural College and Research Institute at Vellayani, and the College of Veterinary and Animal Sciences, Mannuthy, were brought under the Kerala Agricultural University. In addition, twenty one agricultural and animal husbandry research stations were also transferred to the KAU for taking up research and extension programmes on various crops, animals, birds, etc. During 2011, Kerala Agricultural University was trifurcated into Kerala Veterinary and Animal Sciences University (KVASU), Kerala University of Fisheries and Ocean Studies (KUFOS) and Kerala Agricultural University (KAU). Now the University has seven colleges (four Agriculture, one Agricultural Engineering, one Forestry, one Co-operation Banking & Management), six RARSs, seven KVKs, 15 Research Stations and 16 Research and Extension Units under the faculties of Agriculture, Agricultural Engineering and Forestry. In addition, one Academy on Climate Change Adaptation and one Institute of Agricultural Technology offering M.Sc. (Integrated) Climate Change Adaptation and Diploma in Agricultural Sciences respectively are also functioning in Kerala Agricultural University.

Browse

201714
Reset filters
Subject: Agricultural Entomology × End date: 2017 × Start date: 2017 × Thesis Type: M.Sc ×
Reset filters

Search Results

Now showing 1 - 9 of 14
  • Thumbnail Image
    ThesisItemOpen Access
    Morphological variations of root knot nematode in vegetables and banana
    (Department of Agricultural Entomology, College of Agriculture, Vellayani, 2017) Chinchu, P Babu; KAU; Narayana, R
    The study entitled “Morphological variations of root knot nematode in vegetables and banana” was conducted at College of Agriculture, Vellayani during 2015-17 with the objective to study the morphological and morphometric variations of root-knot nematode in brinjal, okra, tomato and banana in Kerala. Morphological and morphometrical studies of females, perineal pattern, second stage juveniles and males of root knot nematodes collected from Dhanuvachapuram, Kattakada and Vellayani of Thiruvananthapuram district; Balagram, Pampadumpara and Thovalappady of Idukki district; Chazhoor, Thalikulam and Thaniyam of Thrissur district infecting brinjal, okra, tomato and banana were done and the data was analysed to identify the species. M.incognita (Kofoid & White, 1919) Chitwood, 1949, M. javanica (Treub, 1885) Chitwood, 1949, M. arenaria (Neal, 1889) Chitwood, 1949 and M. chitwoodi Golden, O'Bannon, Santo & Finley 1980 were identified from brinjal, okra, tomato and banana in Thiruvananthapuram, Idukki and Thrissur districts of Kerala. The study indicated M. incognita as the major species of root knot nematode in Thiruvananthapuram district (91.66%) with highest percentage of occurrence in brinjal and tomato (27.77). In Idukki district, the major species of root knot nematode was M. javanica (66.66%) with highest percentage of occurrence from brinjal and banana (33.33). In Thrissur district, M. arenaria was found to be the major species (66.66%) with highest percentage of occurrence in okra (37.5). M. incognita was found to be the major species in brinjal (55.55%), okra (44.44%), tomato (55.55%) and banana (44.44%) in Thiruvananthapuram, Idukki and Thrissur districts. The extent of parthenogenesis of root knot nematode was found to be very high (97.22%) in these populations. Intraspecific morphological variations were observed within M. incognita, M. javanica and M. arenaria with respect to shape of females, length and position of neck, perineal pattern morphology, tail characters including rectum dilation. Interpopulation comparison of mature females, perineal pattern and second stage juveniles of M. incognita showed that the characters length, width, neck length, stylet length, LMB, WMB and ratio a of females, LVS, AVS, ATT and IPD of perineal pattern and body length, stylet length, H-MB, ABW, tail length, ratio c and c’ were recorded as stable characters. Interpopulation comparison of mature females, perineal pattern and second stage juveniles of M. javanica showed that all the characters of females, perineal pattern and second stage juveniles were stable characters and in M. arenaria, the characters like body length, width, neck length, stylet length, LMB and WMB of females, LVS, AVS, ATT and IPD of perineal pattern and length, stylet length, H-MB, ABW and tail length were recorded as stable characters and found useful in characterizing species. Intraspecific morphological and morphometric variations of M. incognita, M. javanica, M. arenaria were recorded from four host plants in three districts in Kerala. M. arenaria and M. javanica showed high variability between the populations compared to M. incognita in Kerala. The study indicated that M. incognita, M. javanica and M. arenaria were the major species infesting vegetables and banana in Kerala. Among the sampled populations, M. hapla was not identified which shows that M. hapla is not common in Kerala conditions. The study recorded the first report of species having morphological and morphometrical characters similar to M. chitwoodi from okra in Thiruvananthapuram which opens way to molecular studies in future.
  • Thumbnail Image
    ThesisItemOpen Access
    Evaluation of the effect of mineral nutrition in the management of major pests of cowpea
    (Department of Agricultural Entomology, College of Agriculture, padannakkad, 2017) Vishnu Priya, T A; KAU; Sreekumar, K M
    The experiment entitled “Evaluation of the effect of mineral nutrition in the management of major pests of cowpea” was carried out with the objective to assess the effect of mineral nutrients such as potassium, calcium, magnesium, sulphur, silicon, boron, zinc and copper in the pest management of cowpea var. kanakamony. The study was conducted during two seasons viz., rainy and summer season. The data was subjected to statistical analysis to find out the effect of nutrients on management of major pest and biometric and yield parameters of cowpea. The pot culture experiment was conducted in CRD with 12 treatments including control and absolute control with 3 replications each. The plants were raised in pots in three nutrient regimes namely, potting mixture, potting mixture + NPK and potting mixture + NPK +Ca + Mg. Later, the mineral nutrients were applied as foliar spray with 0.2% concentrated solution at different time intervals viz., the branching stage, the peak branching stage and the flower bud initiation stage. The treatments were : T1 -potting mixture (absolute control), T2 ˗P.M + one nutrient spray, T3 -P.M + two nutrient spray, T4 ˗P.M + three nutrient spray, T5 ˗P.M +NPK (control), T6 ˗P.M + NPK + one nutrient spray, T7 ˗P.M + NPK + two nutrient spray, T8 ˗P.M+NPK+three nutrient spray, T9 ˗P.M + NPK + Ca + Mg, T10 ˗P.M + NPK + Ca + Mg + one nutrient spray, T11 ˗P.M + NPK + Ca + Mg + two nutrient spray, T12 ˗P.M + NPK + Ca+ Mg + three nutrient spray. The results of the experiment revealed that aphid infestation, pod borer infestation, pod bug infestation were significantly influenced by treatment effects. In case of aphids (Aphis craccivora), treatment T8 exhibited minimum population score on stem and pods , minimum percentage of pods and shoots infested in both seasons whereas maximum infestation was observed in T12. Treatments which received macro nutrients has shown lowest aphid score on leaves in both seasons. 133 With respect to pod borers ( Maruca vitrata and Lampides boeticus), T12 recorded minimum infestation in both seasons. In summer, pod borer incidence was comparatively low and treatments which received nutrient spray were found free of borer infestation. Pod borers per plant exhibited the same trend as that of percentage of pods infested. With respect to pod bugs, treatments T10 and T11 exhibited lowest infestation whereas T4 and T1 recorded highest pod bug infested pods in rainy and summer season respectively. The effect of mineral nutrients on biometric and yield characters were influenced significantly in both seasons. Treatment T12 registered the highest leaf area, number of leaves, plant height and total biomass whereas T10 recorded the highest marketable and seed yield. The effect of mineral nutrients on pod length, days to flowering and fresh yield varied with seasons. The highest K and S contents were recorded by T10 and highest Si, B and Zn was recorded by T12, T4 and T11 respectively. On comparing the infestation caused by pests in two seasons, cowpea grown with recommended macro nutrients with foliar spray of minerals exhibited the lowest aphid (T8), pod borer (T12) and pod bug incidence (T10, and T11). From economic point of view, T10 can be recommended with respect to higher B-C ratio, highest marketable seed and fresh yield and comparatively lower infestation.
  • Thumbnail Image
    ThesisItemOpen Access
    Potential of the narural bio polymers, chitin and chitosan in pest management
    (Department of Agricultural Entomology, College of Agriculture, Vellayani, 2017) Archana, N H; KAU; Reji Rani, O P
    The investigation entitled “Potential of natural bio polymers, chitin and chitosan in pest management” was conducted at College of Agriculture, Vellayani during 2016-17 with an objective to evaluate the insecticidal properties of the natural biopolymers, chitin and chitosan for utilization in crop pest management. Various formulations tested were, chitin (3%, 5%, 7%), chitosan (3%, 5%, 7%), chitosan gel (3%, 5%, 7%), chitin based commercial formulation, Biorakshak 2% and chitosan based commercial formulation, Bioboost 2%. They were tested for their antifeedant, insecticidal, nematicidal and growth promoting properties by leaf dip method and spray methods in laboratory as well as by foliar spray and soil amendments in pot and field studies. Laboratory studies revealed that the pumpkin caterpillar, Diaphania indica Saunders, the leaf beetle Henosepilachna vigintioctopunctata F., pea aphid Aphis craccivora Koch, the root knot nematode, Meloidogyne incognita (Kofoid and White) Chitwood. and the reniform nematode Rotylenchulus reniformis Linford and Oliveira were vulnerable to different chitin and chitosan based formulations whereas, the cut worm Spodoptera litura F. the leaf weevil, Myllocerus viridanus Schoenherr, the pod bug Riptortus pedestris F. and the spiral nematode Helicotylenchus sp. were not. All the formulations tested were safe to the coccinellid predators, Chilomenes sexmaculata F. and Coccinella transversalis F., the syrphid predators, Ischiodon scutellare F. and Xanthogramma scutellare Thorell. and the spiders Tetragnatha mandibulata Walckenaer and Tetragnatha maxillosa Thorell. Antifeedant effect was noticed only D. indica, chitosan 7% being the superior formulation with 43.25 per cent feeding inhibition on first day which decreased to 13.30 per cent on the fourth day. Insecticidal activity was noticed in H. vigintioctopunctata, chitosan gel 7%, being the best treatment causing 100 per cent mortality on seventh day, followed by Bioboost 2% (93.33 per cent mortality). In A. craccivora, chitin 7% caused 100 per cent mortality on fifth day while Biorakshak 2% recorded 91.66 per cent mortality. Nematicidal effect was noticed in M. incognita and R. reniformis. In M. incognita hatching was reduced by 66.6 per cent for chitosan 5% and chitosan 7%, followed by chitin 7% (53.34 per cent). The juveniles (J2) were highly susceptible to all the formulations at 7% causing 100 per cent mortality on second day. Chitin 7% caused 78.54 per cent mortality in R. reniformis on third day. Pot culture studies revealed that, in brinjal, H. vigintioctopunctata population was lowered in plants treated with chitosan gel 7% and chitosan 7%, the population being 2.86 and 4.83 at seven days after treatment (DAT), while in control it was 9.09 per plant. Incidence of M. viridanus and Aphis gossypii Glover was also less in plants treated with chitosan 7% and chitosan gel 7%. The plant height, number of leaves and branches and were also more in the treatment, chitosan gel 7%. Highest yield was recorded in chitosan 7% (149.69 g plant-1 harvest-1). In cowpea, A. craccivora population was significantly reduced (32.97) in plants treated with chitin 7% while in control it was 197.98 at seven DAT. Plants treated with chitin 7%, chitosan gel 7% and Biorakshak 2% showed less damage of mite, Tetranychus sp. Chitin 7% was the best treatment that favored the growth parameters in cowpea. In tomato, M. incognita population in soil was least in plants treated with chitin 7% and chitosan 7% (36 and 52.13) where as in root samples it was least (278.66) in chitin 7% treated plants. Incidence of Liriomyza trifoli Burgess and cercospora leaf spot was also less in these treatments. Field experiment on cowpea revealed that, chitin 7% took seven days to reduce the population of A. craccivora (164.82 plant-1), followed by chitosan 7% and chitosan gel 7% (189.62 and 214.4 respectively), while in plots treated with dimethoate 30EC @ 0.2% there was complete control. Yield plot-1 was 1.76 kg in chitin 7% and it was 1.8 kg in dimethoate 30EC @ 0.2%. In the field trial on tomato, population of nematodes in soil and root sample were less in plots treated with chitin 7% (152.5, 38.75) than in control plots (532.75, 123.75), while in chemical treatment with cartap hydrochloride 4G @ 1 kg a.i.ha-1 it was 72.25 and 5.5 respectively. The incidence of L. trifoli was less in chitin 7% treated plants and that of leaf curl virus was less in treated plants when compared to control. Significantly high yield was noted with crude chitin 7g kg-1 (2.39 kg plot-1) compared to control (1.10 kg plot-1). The study indicated that the potential of natural biopolymers chitin and chitosan can be exploited for the holistic management of crop plants as it has capacity to regulate the population of insect and nematode pests as well as plant diseases. The growth and yield promoting attributes and safety to natural enemies makes them ideal candidates in integrated pests and disease management as well as integrated nematode management programmes.
  • Thumbnail Image
    ThesisItemOpen Access
    Response of selected okra [Abelmoschus esculentus (L.) Moench] cultivars to root knot nematode meloidogyne incognita (Kofoid and White)
    (Department of Agricultural Entomology, College of Horticulture, Vellanikkara, 2017) Chandini, S M; KAU; Susannamma Kurien
    Okra [Abelmoschus esculentus (L.) Moench] is an important vegetable crop, popularly known as “bhendi” or “lady’s finger” in India. It is grown in three seasons in the tropical and subtropical regions throughout the world. The nutritional, medicinal and industrial value of okra fruits makes it a promising vegetable crop globally. Pests and diseases are the major limiting factors for okra cultivation. Among them plant parasitic nematodes are the most serious. Root-knot nematode, Meloidogyne incognita is one of the most economically damaging genera of plant parasitic nematodes which causes 31 per cent of yield loss in India (Jain et al., 2006). Several methods have been developed for the management of the nematode. Use of chemical nematicides is the most effective, which brings about 80 per cent reduction in nematode population. Host resistance is an important component of integrated nematode management. Use of cultivars resistant to M. incognita is one of the best alternatives, which is specific, environmentally safe and economically feasible. In this context, a study entitled “Response of selected okra [Abelmoschus esculentus (L.) Moench] cultivars to root knot nematode, Meloidogyne incognita (Kofoid and White)” was carried out in the Department of Agricultural Entomology, College of Horticulture, Vellanikkara during January 2016 to October 2016, with the objective of screening selected okra cultivars against M. incognita and to elucidate the biochemical basis of resistance. Thirty okra cultivars comprising twenty one accessions from NBPGR Regional Station, Thrissur, eight released varieties and a highly susceptible check (Arka Anamika) were screened for their reaction to root knot nematode M.incognita. Pot culture experiment was conducted in Completely Randomized Design with three replications and 30 treatments. Okra plants were inoculated with M.incognita @ one second stage juvenile per gram of soil after two weeks of seed germination. Biometric characters like plant height, number of leaves, number of flowers, number of fruits and fruit weight were recorded at fortnightly intervals from the time of inoculation till uprooting. Shoot weight, root weight, root knot number and nematode population in soil and roots were also recorded when the plants were uprooted i.e. three months after inoculation. Significant reductions in all the biometric parameters were observed over their respective controls in all the cultivars. The per cent decrease in these parameters were higher in highly susceptible and susceptible cultivars than moderately resistant cultivars. Based on the number of galls per 10 g roots, indexing was done on 1-5 scale and the okra cultivars were categorized as highly resistant, resistant, moderately resistant, susceptible and highly susceptible (Devi et al., 2014). None of the cultivars were highly resistant or resistant whereas four cultivars viz., IC 117238, IC 117251, IC 111507 and Varsha Uphar with root knot index 3 were classified as moderately resistant. Seven cultivars viz., Manjima, IC 111536, IC 117260, IC 111500, IC 111247, IC 469689 and IC 111517 were found to be susceptible with root knot index 4. Rest of the nineteen cultivars viz., Aruna, Kiran, Anjitha, Salkeerthi, Susthira, Arka Anamika, Pusa Sawani, IC 218900, IC 112457, IC 329360, IC 045819, IC 117308, IC 117228, IC 111525, IC 111514, IC 329357, IC 282275, IC 305634 and IC 045515 were classified as highly susceptible with root knot index 5. Biochemical parameters like total phenol, peroxidase (PO), total sugar and reducing sugar of both control and inoculated roots of okra cultivars were estimated at three months after inoculation based on standard procedures to analyze the biochemical bases of resistance. An increase in total phenol and peroxidase activity was noticed in moderately resistant cultivars than susceptible cultivars whereas total sugar and reducing sugars were higher in highly susceptible cultivars. Correlation analysis showed a significant negative correlation between total phenol content and peroxidase activity with number of root knots, root knot index and population of M. incognita in root and soil. A significant positive correlation of total sugar and reducing sugar was recorded with number of root knots, root knot index and population of M. incognita in root and soil. The present study revealed that IC 117238, IC 117251, IC 111507 and Varsha Uphar were moderately resistant. Hence these cultivars could be utilized as resistant sources for further breeding programmes. Field trials in sick plots also need to be conducted to study the field performance of the moderately resistant cultivars.
  • Thumbnail Image
    ThesisItemOpen Access
    Bioefficacy of the acaropathogen, acremonium zeylanicum (petch) gams and evans against the spider mite, tetranychus truncatus ehara (acari: tetranychidae)
    (Department of Agricultural Entomology, College of Horticulture, Vellanikkara, 2017) Alka Sherief; KAU; Haseena Bhaskar
    Spider mites (Prostigmata: Tetranychidae) cause severe injury to vegetables grown under both protected and open field conditions. Awareness on the ill effects associated with the use of synthetic chemicals in pest management has resulted in an increased demand for safe to eat food. Hence, ecofriendly strategies for the management of mite assume high priority. Investigations on potential natural enemies of spider mites by All India Network Project on Agricultural Acarology (AINPAA) have identified an acaropathogenic fungus, Acremonium zeylanicum (Petch) Gams and Evans from the spider mite, Tetranychus urticae Koch on brinjal from Thrissur district. The present study was undertaken at the Department of Agricultural Entomology, College of Horticulture, Vellanikkara during 2016 - 2017 in the above context to investigate the biocontrol potential of the acaropathogen, A. zeylanicum against the predominant species of spider mite in Kerala, Tetranychus truncatus Ehara; to assess the sensitivity of the acaropathogen to selected novel acaricides and botanicals and also to evaluate its safety to the predatory mite, NeosAcremonium zeylanicum was evaluated along with two novel acaricides and two botanicals against T. truncatus on cucumber under polyhouse conditions. A. zeylanicum significantly reduced mite population seven days after treatment at both 1×108 spores ml-1 (72.71%) and 1×107 spores ml-1 (55.03%). However the novel aceiulus longispinosus (Evans). Laboratory bioassay conducted to evaluate the efficacy of A. zeylanicum at five different concentrations viz.1×105, 1×106, 1×107, 1×108 and 1×109 spores ml-1 against T. truncatus recorded more than 50 per cent mortality of adult mites within six days at both 1×108 and 1×109 spores ml-1. The mortality increased with increase in concentration of the fungus and also with progress in time. The highest mortality of 68.36 per cent was recorded by A. zeylanicum applied at the rate of 1×109 spores ml-1 seven days after treatment, which was on par with 61.65 per cent mortality recorded at 1×108 spores ml-1. The fungus was more effective against adult stage compared to egg stage of T. truncatus. The highest mortality of egg stage (41.33%) was recorded four days after the treatment at 1×10 9 spores ml-1. aricides (spiromesifen & diafenthiuron) and botanicals (neem oil & azadirachtin) were significantly superior to the acaropathogen in reducing the mite population. Compatibility study of A. zeylanicum with different agrochemicals revealed that the acaricides, spiromesifen and fenpyroximate were relatively safer to the fungus. The fungicides, Curzate M8 (Cymoxanil 8% + Mancozeb 64 %) and Equation Pro (Fomaxadone 16.6%+ Cymoxanil 22.1%) recorded highest per cent inhibition and were followed by the acaricides, fenazaquin, diafenthiuron, propargite and the botanicals azadirachtin and neem oil. Laboratory evaluation of safety of A. zeylanicum to the predatory mite N. longispinosus showed that the predatory mite was less susceptible to A. zeylanicum than the prey mite, T. truncatus. The pathogen did not have any ovicidal effect and had caused much lower mortality of 20 per cent on adults of N. longispinosus at the highest dose of 1×108 spores ml-1. The study indicated the potential of A. zeylanicum in reducing mite population significantly both in laboratory and polyhouse. The pathogen was found to be compatible with commonly used acaricides and also was safe to the predominant predatory mite species in vegetable ecosystems. Thus it can be inferred that the acaropathogen A. zeylanicum could be a valuable component in integrated mite management programme in vegetables.
  • Thumbnail Image
    ThesisItemOpen Access
    Bioecology of small hive beetles and assessment of their damage in stingless bee colonies
    (Department of Agricultural Entomology, College of Agriculture, Vellayani, 2017) Gayathri, P Bose; KAU; Amritha, V S
    The study entitled “Bioecology of small hive beetles and assessment of their damage in stingless bee colonies” was conducted with the objectives to study the incidence, bioecology and the extent of damage by small hive beetles in stingless bee colonies. The study was conducted during the period 2015-2017 at Department of Agricultural Entomology, College of Agriculture,Vellayani. A survey was conducted in Southern districts of Kerala viz., Thiruvananthapuram, Kollam and Pathanamthitta. Seven beetles (five nitidulids, one cryptophagid and one tenebrionid) were collected from the hives during the survey. Among these, the nitidulid beetle which caused the primary infestation is identified as Epuraea latissima Kirejtshuk and it is the first report from stingless bee hive. Monthly incidence of the hive beetle revealed that peak period of infestation was recorded from Thiruvananthapuram in the month of June, whereas in Kollam district, it was during June and July. However, the incidence was recorded only during the month of May from Pathanamthitta district. Among the three districts, highest incidence of small hive E. latissima beetle was recorded from Kollam (19.00 %), followed by Thiruvananthapuram (16.00 %) and Pathanamthitta (3.00 %). The type of hive used for maintaining the stingless bee colony is an important factor which determines the hive beetle incidence. Majority of bee keepers maintained stingless bees in wooden box (59.33 %) followed by mud pots (18.66 %). Among the wooden boxes, the incidence was more prominent in bad quality wooden boxes (made of locally available soft wood) in Thiruvananthapuram (60 %), Kollam (50 %) and Pathanamthitta districts (15 %). Studies on the influence of height of the stingless bee hive from the ground level with the hive beetle incidence revealed that the hives kept at 3-4 m recorded the highest incidence (24.79 %) followed by 2-3 m (8.04 %). The colonies maintained at a height of > 4 m were free from hive beetle incidence. Regarding the incidence of small hive beetle in different shade conditions, highest hive beetle incidence (50.70 %) was recorded from apiaries under high shade condition (>80 % canopy coverage) followed by moderate (30-80 % canopy coverage) shade condition (0.90 %). The damage symptoms recorded from infested colonies were fermentation and discolouration of honey due to the feeding and defecation by the beetle larvae and a light brown coloured undistinguished mass of hive contents. Apart from the small hive beetles, black soldier fly, Hermetia illucens L., pollen mites and ants were also documented as pests of stingless bees from the apiaries of Southern Kerala. Regarding the studies on biology of the hive beetle, egg period, larval and pupal period of the beetle was recorded as 2.2 ± 0.537, 14.2 ± 1.686 and 17.77 ± 0.963 days respectively. The length and width of egg, larva, pupa and adult was recorded as 0.551 ± 0.037× 0.173 ± 0.003 mm, 4.471 ± 0.159 × 1.062 ± 0.025 mm, 2.515 ± 0.123× 1.1124 ± 0.044 mm and 3.0897 ± 0.454 × 1.378 ± 0.0758 mm respectively. The larvae caused severe damage by tunneling and feeding the pollen pots while the adults nibbled the hive contents. Studies on the correlation between larval population and weather parameters showed a significant positive correlation with rainfall and relative humidity. Highest population of grubs was recorded on 2nd fortnight of May. The time taken by the grubs for complete destruction of pollen block (4 cm3) was recorded as 16 days, whereas for the destruction of brood cells and honey block of 4 cm3, it took 13.50 days and 10.83 days respectively. The small hive beetle which primarily infested the stingless bee colonies is identified as the nitidulid beetle, E. latissima. The hive beetle incidence can be reduced by using good quality wooden boxes, where the bad quality wooden boxes along with high rainfall predisposes hive beetle incidence in the apiaries.
  • Thumbnail Image
    ThesisItemOpen Access
    Seasonal incidence of predatory wasp (Vespa spp.) in Indian bee apiaries and evaluation of bait traps
    (Department of Agricultural Entomology, College of Agriculture, Vellayani, 2017) Ann Verghese, Kolady; KAU; Amritha, V S
    The study entitled “Seasonal incidence of predatory wasp (Vespa spp.) in Indian bee apiaries and evaluation of bait traps” was carried out in the Department of Agricultural Entomology, College of Agriculture, Vellayani during 2015-17. The objective was to study the seasonal incidence of Vespa spp. in Indian honey bee apiaries, assessment of its predatory potential and evaluation of bait traps against the wasp. The observations were recorded throughout the three beekeeping seasons (lean season, brood rearing season and honey flow season) of the year 2016-17 in the apiaries at Nedumangad, Vilappilshala, Vellayani and Balaramapuram. The incidence of honey bee pests’ viz. wax moth, spiders, wasps, ants, lizard, honey buzzard and monkey, their symptoms and mode of attack were documented. The damage by larvae of wax moth (Galleria mellonella Linnaeus) was observed as galleries and faecal pellets of excreta in the brood comb. The spiders predating on bees were identified as Argiope anasuja Thorell, Hersilia savigyni Lucas and Thomisus lobosus Tikader. The predatory wasp collected from the apiaries was identified as Vespa tropica Linnaeus. Among the ants, the weaver ant, Oecophylla smaragdina Fabricius and godzilla ant, Camponotus compressus Fabricius predated on the bees whereas, the yellow crazy ant, Anoplolepis gracilipes Smith fed on the hive honey. Cent per cent infestation by ants were observed in the apiaries which was followed by the wasps (59.86 %) and wax moth (34.87 %). The infestation by the spiders, lizard (Hemidactylus sp.), honey buzzard and monkey (Macaca radiata Geoffroy) was found to be the least. Though the predatory wasp was observed in the apiary premises throughout the day, the peak period was found to be from 0930 to 1030 hour (26 visits hr-1), which corresponds to the active foraging hours of honey bees. Maximum wasp incidence was observed during the month of November (181 visits). Of the four locations, the highest wasp incidence (251 visits) was recorded at Nedumangad which may be due the hilly areas and thick vegetation in that region. Studies on the seasonal incidence of V. tropica revealed that significantly higher wasp population was observed during the brood rearing season than the lean season and honey flow season. Correlation studies of the wasp incidence with the weather data (monthly basis) showed a non-significant relationship with all the weather parameters (temperature, relative humidity and rainfall). Studies on the predatory potential of wasp revealed that the bees were found predated by the wasps only for five weeks i.e., from 41st week to 44th week and also in 48th week. Out of the 52 bees predated by the wasp, maximum predation (18 Nos.) was recorded in 44th week (31st October, 2016 to 6th November, 2016). Observations on the predatory strategy of wasps showed four distinct behaviour viz., arrival, approach, attack and predation. The bees failed to show defense response to the injured wasp placed at the hive entrance and continued their usual foraging behaviour. On facing persistent attack by the wasps, the bees ceased foraging activities, buzzed around and guarded the hive entrance. The frustrated bees were also found to engulf the wasp in a ball of bees, rendering it immovable. Evaluation of bait traps using carbohydrate based - fermented pineapple + molasses (4:1) (150 g) and protein based - beef (50 g), chicken (50 g), fish (50 g) along with untreated control (water) revealed that no traps were efficient in trapping the wasps. More number of bees (22 Nos.) were trapped in carbohydrate based trap (fermented pineapple + molasses trap), rather than the wasps (0.5 Nos.). Other insects were also trapped. The predation of honey bees by the wasp recorded in the apiaries was 59.86 per cent with peak incidence during the month of November. Significantly higher wasp population was observed during the brood rearing season (September - December) of honey bees. Maximum predation of bees (18 Nos.) was observed in the 44th week. Since no bait traps were found efficient in trapping the wasps, a new method has to be developed against the wasp.
  • Thumbnail Image
    ThesisItemOpen Access
    Management of major chewing pests, henosepilachna septima (Dieke) and diaphania indica (Saund) infesting bitter gourd with bacterial bioagents
    (Department of Agricultural Entomology, College of Agriculture, Vellayani, 2017) Liz, J Mampallil; KAU; Faizal, M H
    The study entitled “Management of major chewing pests, Henosepilachna septima (Dieke) and Diaphania indica (Saund) infesting bitter gourd with bacterial bioagents” was conducted during the period 2015-2017, in the Department of Agricultural Entomology at College of Agriculture, Vellayani. The objective was to manage the chewing pests using phylloplane and pathogenic bacteria. Thirteen bacteria were isolated from the phylloplane of bitter gourd by taking leaf impression on M-9 minimal agar media. Upon preliminary screening for pathogenicity, three isolates (isolate 1, 5 and 7) were found to be pathogenic to H. septima and four (isolate 3, 5, 7 and 12) to D. indica. Laboratory evaluation of pathogenic phylloplane isolates was done by oral exposure adopting leaf disc method, along with other entomopathogenic bacteria viz, Serratia marcescens (Hv3) obtained from H. vigintioctopunctata, Pseudomonas fluorescens (PN026R) and Bacillus thuringiensis var. kurstaki. Treatments with S. marcescens (Hv3) and isolate 5 were found to be significantly superior in causing mortality to H. septima grubs at 1, 3, 5 and 7 DAT. Mortality of 90 per cent and 83.33 per cent were observed for S. marcescens (Hv3) and isolate 5 respectively at 5 DAT. Leaf area damage was also found to be significantly low in treatments with S. marcescens (Hv3) and isolate 5 (7.93 per cent and 14.68 per cent respectively) than control (100 per cent) at 5 DAT. S. marcescens (Hv3) and isolate 5 were found to be effective against D. indica also, causing 96.67 per cent and 93.33 per cent mortality at 5 DAT, which was equally effective as chemical insecticide (Flubendiamide 39.35 SC, 0.004%) and commercial microbial pesticide, B. thuringiensis. Larvae treated with S. marcescens (Hv3) and isolate 5 caused leaf area damage of 2.71 per cent and 5.23 per cent only as against 77.75 per cent in control. Internal transcribed regions of DNA of 16S rRNA of isolate 5 and 7 were amplified using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer in PCR. Blast search of amplified DNA in NCBI data base revealed the identity of isolate 5 and 7 as Serratia marcescens and Klebsiella sp respectively with 99 per cent and 100 per cent homology. The identity of the bacteria were further confirmed by biochemical analysis in which isolate 5 exhibited negative reaction with respect to urease, malonate and raffinose characteristic to S. marcescens, and isolate 7 exhibited urease, melibiose and glucose positive reaction, characteristic to Klebsiellla sp. Chitinase activity of 1.24 and 1.07 units were recorded in S. marcescens (pmc5) and Klebsiellla sp respectively using chitin azure method, indicating the potential of these phylloplane bacteria in breaching the peritrophic membrane of chewing insects. A pot culture experiment was carried out to evaluate the efficacy of foliar application of selected bacteria @ 108 cfu ml-1 against chewing insects in bitter gourd. The phylloplane isolate S. marcescens (pmc5) produced significantly high mortality in both H. septima (65.83 per cent) and D. indica larvae (87.78 per cent) at 7 DAT, which was on par with chemical treatment quinolphos 0.05%. Treatments with S. marcescens (Hv3) obtained from H. vigintioctopunctata which produced high mortality of 42.06 per cent in H. septima and 49.01 per cent and 57.14 per cent in D. indica at 5 and 7 DAT was the next best treatment. At 5 DAT plants treated with S. marcescens (pmc5) showed significantly low population of H. septima grubs (6.46 grubs plant-1) and D. indica (2.08 larvae plant- 1 ) than control (17.23 grubs plant-1 and 17.68 larvae plant-1). Plants treated with S. marcescens (pmc5) showed 68.78 per cent and 71.91 per cent leaf area damage reduction over untreated control by H. septima and D. indica respectively at 5 DAT. S. marcescens (Hv3) treatment caused 61.30 per cent and 53.53 per cent reduction of leaf area damage by H. septima and D. indica respectively over untreated control at 5 DAT. Thus, S. marcescens (pmc5), isolated from phylloplane of bitter gourd is found effective against chewing pests of bitter gourd. Since the field use in live form of S. marcescens is limited due to its opportunistic animal pathogenic nature, investigations have to be undertaken on insect toxic secondary metabolites produced by it to yield biocontrol products.
  • Thumbnail Image
    ThesisItemOpen Access
    Population dynamics, biology and management of mealybug, phenacoccus solenopsis tinsley (Hemiptera: pseudococcidae) on okra
    (Department of Agricultural Entomology, College of Horticulture, Vellanikkara, 2017) Anusree Padmanabhan, P S; KAU; Mani Chellappan
    Cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) is a highly polyphagous pest that infest more than 154 species of plants mostly belonging to Asteraceae, Malvaceae, Solanaceae, Amaranthaceae, and Euphorbiaceae. It causes severe damage to crops grown under both protected as well as open field conditions. Use of broad spectrum synthetic insecticides to manage the mealybug is a restricted option owing to concerns about residue, interference with natural enemies etc. Hence, it is necessary to study the host range, biology and to develop alternative ecofriendly strategies for the management of the mealybug. The study entitled “Population dynamics, biology and management of mealybug P. solenopsis Tinsley (Hemiptera: Pseudococcidae) on okra” was undertaken at the AINPAO (All India Network Project on Agricultural Ornithology) laboratory, Dept. of Agrl. Entomology, College of Horticulture, Vellanikkara during March 2016 – May 2017. The objectives of the study were to study the population dynamics, biology and management of P. solenopsis and characterization of its endosymbionts. To document the host range and natural enemies of P. solenopsis, purposive survey was conducted in Thrissur district. P. solenopsis was recorded on more than 40 plants, the majority of which belonged to the families viz., Asteraceae, Malvaceae, Solanaceae and Amaranthaceae. As the population of mealybug on okra fields was negligible during survey, study on population dynamics was carried out on major host plants recorded viz., Sida acuta Burm.f., Abutilon indicum (Link) Sweet, Hibiscus rosa-sinensis L.and Amaranthus viridis L. Population of mealybug was found to be high during summer (March 2016 to July 2016) and winter seasons (November 2016 to February 2017). Natural enemies recorded included a predator [Spalgis epius (Westwood)] and four parasitoids [Aenasius arizonensis (Girault), Anicetus sp., Myiocnema comperei Ashmead and Prochiloneurus spp.]. Molecular characterization of mealybug was done to confirm the species identity prior to studies on biology. Mass culturing of mealybug was done on potato sprouts. The mealybugs reproduced through ovo-viviparity and parthenogenesis. Life cycle of female mealybug consisted of three nymphal instars and an adult stage, whereas that of male mealybug consisted of an additional pupal stage along with three nymphal instars. The mean duration of first and second nymphal instars was 4.27 and 6.67 days. The average third nymphal instar duration was 4.8 days. Mean pupal period in male mealybug was 6.8 days. Adult female lived for an average of 38.75 days with pre-oviposition, oviposition and post-oviposition period of 5, 11.5 and 0.5 days respectively. Adult male lived for only an average of 1.7 days. Adult female deposited an average of 171 crawlers with a female to male sex ratio of 1: 0.03. Number of antennal segments varied among each instars. The first and second instar nymphs had six antennal segments, while the third instar nymphs and adult stage possessed seven and nine antennal segments, respectively. Study on damage assessment on okra by P. solenopsis showed that second and third instar nymphs produce profuse crinkling and yield loss in okra. Apot culture experiment was conducted to evaluate the efficacy of entomopathogenic fungi viz., Paecilomyces lilacinus (Thom) Samson and Lecanicillium lecanii (Zimm.) Zare& Gams each at three different concentrations of 1 × 107, 1 × 108 and 1 × 109 spores ml-1, along with two botanicals viz., NSKE @ 5% and neem oil soap @ 2 %, chemical insecticides viz., buprofezin 250 g a.i. ha-1 and thiamethoxam 25 g a.i. ha-1 with an untreated control. Thiamethoxam recorded the highest mortality of 75.94 per cent seven days after treatment followed by buprofezin and NSKE with mean mortality of 37.02 and 26.52 per cent, respectively. Entomopathogenic fungi, L. lecanii at 1×108spores ml-1(21.89%) was on par with P. lilacinus at 1 × 107 spore ml-1 (20.72%). The mortality of mealybug increased with time lapse after spray application. On the 14th day, highest mortality of 83.54 per cent was recorded in the treatment NSKE which was on par with thiamethoxam (81.74%). P. lilacinus at 1 × 109spores ml-1 and L. lecanii at 1 × 108 spores ml-1 were found to be the best treatments among entomopathogenic fungi. Analysis of gut microbiota showed the presence of endosymbiotic bacteria belonging 63 families which constituted 189 species. The major species identified were Candidatus Tremblaya princeps, Klebsiella sp., Pantoea agglomerans (Ewing and Fife) and Wigglesworthia glossinidia Aksoy. Many of the endosymbiotic bacteria are attributed in the survival of insects against toxicants.