Thumbnail Image

University of Agricultural Sciences, Bengaluru

University of Agricultural Sciences Bangalore, a premier institution of agricultural education and research in the country, began as a small agricultural research farm in 1899 on 30 acres of land donated by Her Excellency Maharani Kempa Nanjammanni Vani Vilasa Sannidhiyavaru, the Regent of Mysore and appointed Dr. Lehmann, German Scientist to initiate research on soil crop response with a Laboratory in the Directorate of Agriculture. Later under the initiative of the Dewan of Mysore Sir M. Vishweshwaraiah, the Mysore Agriculture Residential School was established in 1913 at Hebbal which offered Licentiate in Agriculture and later offered a diploma programme in agriculture during 1920. The School was upgraded to Agriculture Collegein 1946 which offered four year degree programs in Agriculture. The Government of Mysore headed by Sri. S. Nijalingappa, the then Chief Minister, established the University of Agricultural Sciences on the pattern of Land Grant College system of USA and the University of Agricultural Sciences Act No. 22 was passed in Legislative Assembly in 1963. Dr. Zakir Hussain, the Vice President of India inaugurated the University on 21st August 1964.

Browse

20202
Reset filters
Subject: Agricultural Entomology × Author: HEMANT KUMAR × Start date: 2020 × Type: Thesis × Thesis Type: M.Sc ×
Reset filters

Search Results

Now showing 1 - 2 of 2
  • Thumbnail Image
    ThesisItemOpen Access
    CRISPR/Cas9 BASED EDITING OF SOME IMPORTANT GENES OF MANGO FRUIT FLY, Bactrocera dorsalis (Hendel) (DIPTERA: TEPHRITIDAE)
    (University of Agricultural Sciences, Bangalore, 2020-11-13) HEMANT KUMAR; R. ASOKAN
    The utility of genome editing in the Bactrocera dorsalis by CRISPR/Cas method was evaluated. We used ribonucleoprotein (RNP) complexes assembled with Cas9 endonuclease as a single guide RNA (sgRNA) engineered with the target pigmentation gene (white) and spermatogenesis (per). The embryos, along with the white gene sgRNA-AS443 (ACCGTTCAGCAAGCGTACGG) (100pmol), Cas9 (400 pmol) and Tris Buffer (10mM) were subjected to electroporation with 800 V@500μs. In contrast to the wild brown reddish eye type, the developing adult flies displayed a blackish green eye colour with altered head pigmentation. Compared to the wild style with different spots, all the head spots were indistinct in the edited type. With lighter pigmentation, the thoracic plate in the edited form was yellowish, while in the wild type it was more melanized and whitish yellow. In order to obtain more G0 phased embryo numbers, optimization of egg laying was carried out, which showed that the banana pulp was B. dorsalis most favoured oviposition substrate. There was no significant difference between water media and 0.5% solidified agar media for egg processing, while after incubation, survivability in water media was found to be higher. The peak time of egg laying was found in the 21-43-day (23.93±10.10 eggs) age range. Five flies per box with an average number of eggs of 162.83±75.80 in the 1st hour, 107±92.19 in the 2nd hour and 142.66±29.27 in the 3rd hour is deemed better handling. The research reveals that synthetic RNP complexes constructed in vitro can be used in studies of genetic manipulation.
  • Thumbnail Image
    ThesisItemOpen Access
    CRISPR/Cas9 BASED EDITING OF SOME IMPORTANT GENES OF MANGO FRUIT FLY, Bactrocera dorsalis (Hendel) (DIPTERA: TEPHRITIDAE)
    (University of Agricultural Sciences, Bangalore, 2020-11-13) HEMANT KUMAR; R. ASOKAN
    The utility of genome editing in the Bactrocera dorsalis by CRISPR/Cas method was evaluated. We used ribonucleoprotein (RNP) complexes assembled with Cas9 endonuclease as a single guide RNA (sgRNA) engineered with the target pigmentation gene (white) and spermatogenesis (per). The embryos, along with the white gene sgRNA-AS443 (ACCGTTCAGCAAGCGTACGG) (100pmol), Cas9 (400 pmol) and Tris Buffer (10mM) were subjected to electroporation with 800 V@500μs. In contrast to the wild brown reddish eye type, the developing adult flies displayed a blackish green eye colour with altered head pigmentation. Compared to the wild style with different spots, all the head spots were indistinct in the edited type. With lighter pigmentation, the thoracic plate in the edited form was yellowish, while in the wild type it was more melanized and whitish yellow. In order to obtain more G0 phased embryo numbers, optimization of egg laying was carried out, which showed that the banana pulp was B. dorsalis most favoured oviposition substrate. There was no significant difference between water media and 0.5% solidified agar media for egg processing, while after incubation, survivability in water media was found to be higher. The peak time of egg laying was found in the 21-43-day (23.93±10.10 eggs) age range. Five flies per box with an average number of eggs of 162.83±75.80 in the 1st hour, 107±92.19 in the 2nd hour and 142.66±29.27 in the 3rd hour is deemed better handling. The research reveals that synthetic RNP complexes constructed in vitro can be used in studies of genetic manipulation.