Loading...
Thumbnail Image

Govind Ballabh Pant University of Agriculture and Technology, Pantnagar

After independence, development of the rural sector was considered the primary concern of the Government of India. In 1949, with the appointment of the Radhakrishnan University Education Commission, imparting of agricultural education through the setting up of rural universities became the focal point. Later, in 1954 an Indo-American team led by Dr. K.R. Damle, the Vice-President of ICAR, was constituted that arrived at the idea of establishing a Rural University on the land-grant pattern of USA. As a consequence a contract between the Government of India, the Technical Cooperation Mission and some land-grant universities of USA, was signed to promote agricultural education in the country. The US universities included the universities of Tennessee, the Ohio State University, the Kansas State University, The University of Illinois, the Pennsylvania State University and the University of Missouri. The task of assisting Uttar Pradesh in establishing an agricultural university was assigned to the University of Illinois which signed a contract in 1959 to establish an agricultural University in the State. Dean, H.W. Hannah, of the University of Illinois prepared a blueprint for a Rural University to be set up at the Tarai State Farm in the district Nainital, UP. In the initial stage the University of Illinois also offered the services of its scientists and teachers. Thus, in 1960, the first agricultural university of India, UP Agricultural University, came into being by an Act of legislation, UP Act XI-V of 1958. The Act was later amended under UP Universities Re-enactment and Amendment Act 1972 and the University was rechristened as Govind Ballabh Pant University of Agriculture and Technology keeping in view the contributions of Pt. Govind Ballabh Pant, the then Chief Minister of UP. The University was dedicated to the Nation by the first Prime Minister of India Pt Jawaharlal Nehru on 17 November 1960. The G.B. Pant University is a symbol of successful partnership between India and the United States. The establishment of this university brought about a revolution in agricultural education, research and extension. It paved the way for setting up of 31 other agricultural universities in the country.

Browse

Search Results

Now showing 1 - 2 of 2
  • ThesisItemOpen Access
    Studies on stem necrosis disease of potato caused by Groundnut bud necrosis virus
    (G.B. Pant University of Agriculture and Technology, Pantnagar - 263145 (Uttarakhand), 2012-08) Mohammad Ansar; Pundhir, V.S.
    Potato, one of important and popular vegetable, is consumed throughout the year in all parts of India. The crop in Tarai region of Uttarakhand is adversely affected by several biotic factors. Stem necrosis disease is an emerging problem in this area, which has become a serious problem on the early planted crop in the central western parts of India. Disease incidence up to 90% was recorded in some parts of Madhya Pradesh and Rajasthan and yield losses due to the disease vary greatly 15-30% from place to place and year to year. Keeping in view of economic importance and potential threat of the new disease, the present investigation was undertaken to study the occurrence, molecular characterization of virus, disease development under different treatments, comparative assessment of disease at two locations (Kota and Pantnagar), effect of disease on different cultivars and germplasm screening. The causal agent of disease, a virus was confirmed by RT-PCR using specific primer pair, HRP26-5’ATGTCTAACGTYAAGCARCTG 3’/HRP28-5’ TTACAATTCCAGCGAAGGACC 3’ targeting NP gene of GBNV. Infected samples provide suitable templates for use in RT-PCR and a cDNA fragment of expected size (~800 bp) was observed, suggesting the association of GBNV with stem necrosis samples. At nucleotide and amino acid level, the present virus isolate GBNV-[Pot-USN] had more than 90 per cent identities with known GBNV isolates. This is the first authenticated report of GBNV, a Tospovirus, infection in Tarai region of Uttarakhand on potato. Sap inoculation on cowpea plants, Pusa Komal, produced characteristic symptoms. Thrips inoculated plant showed necrotic elongated spots on young stem in varying acquisition and inoculation assess periods. During cropping season 2010-11and 2011-12 the results revealed that more disease incidence (39.55 and 44%) was recorded in early planted crop and late planted crop showed less disease incidence (3.1 and 3.3%) in insecticide application plots. In general comparatively higher disease severity was recorded in third (22.15%) and fourth (25.15%) week of January 2011. Whereas it was between 23.40 and 30.23% in first and second week of January, 2012, respectively. In study of Kota and Pantnagar location, the incidence of disease was higher (59%) in the crop planted on 17th October at Kota, however at Pantnagar it was 36.67%. Effect of disease on six popular cutivars, maximum disease incidence (7.33 and 8.63%) recorded in Kufri Bahar at VRC in two cropping seasons, respectively, while in case of K. Jyoti under similar condition, the disease incidence were 1.40 and 1.43 in two season. Out of 60 potato germplasms screened under field conditions, 10 were found highly resistant, whereas 22 were resistant and 9 were moderately resistant. Nine germplasms were categorized as susceptible and 10 as highly susceptible.
  • ThesisItemOpen Access
    Studies on stem necrosis disease of potato caused by groundnut bud necrosis virus
    (G.B. Pant University of Agriculture and Technology, Pantnagar - 263145 (Uttarakhand), 2012-08) Mohammad Ansar; Pundhir, V.S.
    Potato, one of important and popular vegetable, is consumed throughout the year in all parts of India. The crop in Tarai region of Uttarakhand is adversely affected by several biotic factors. Stem necrosis disease is an emerging problem in this area, which has become a serious problem on the early planted crop in the central western parts of India. Disease incidence up to 90% was recorded in some parts of Madhya Pradesh and Rajasthan and yield losses due to the disease vary greatly 15-30% from place to place and year to year. Keeping in view of economic importance and potential threat of the new disease, the present investigation was undertaken to study the occurrence, molecular characterization of virus, disease development under different treatments, comparative assessment of disease at two locations (Kota and Pantnagar), effect of disease on different cultivars and germplasm screening. The causal agent of disease, a virus was confirmed by RT-PCR using specific primer pair, HRP26-5’ATGTCTAACGTYAAGCARCTG 3’/HRP28-5’ TTACAATTCCAGCGAAGGACC 3’ targeting NP gene of GBNV. Infected samples provide suitable templates for use in RT-PCR and a cDNA fragment of expected size (~800 bp) was observed, suggesting the association of GBNV with stem necrosis samples. At nucleotide and amino acid level, the present virus isolate GBNV-[Pot-USN] had more than 90 per cent identities with known GBNV isolates. This is the first authenticated report of GBNV, a Tospovirus, infection in Tarai region of Uttarakhand on potato. Sap inoculation on cowpea plants, Pusa Komal, produced characteristic symptoms. Thrips inoculated plant showed necrotic elongated spots on young stem in varying acquisition and inoculation assess periods. During cropping season 2010-11and 2011-12 the results revealed that more disease incidence (39.55 and 44%) was recorded in early planted crop and late planted crop showed less disease incidence (3.1 and 3.3%) in insecticide application plots. In general comparatively higher disease severity was recorded in third (22.15%) and fourth (25.15%) week of January 2011. Whereas it was between 23.40 and 30.23% in first and second week of January, 2012, respectively. In study of Kota and Pantnagar location, the incidence of disease was higher (59%) in the crop planted on 17th October at Kota, however at Pantnagar it was 36.67%. Effect of disease on six popular cutivars, maximum disease incidence (7.33 and 8.63%) recorded in Kufri Bahar at VRC in two cropping seasons, respectively, while in case of K. Jyoti under similar condition, the disease incidence were 1.40 and 1.43 in two season. Out of 60 potato germplasms screened under field conditions, 10 were found highly resistant, whereas 22 were resistant and 9 were moderately resistant. Nine germplasms were categorized as susceptible and 10 as highly susceptible.