Loading...
Anand Agricultural University, Anand
Anand Agricultural University (AAU) was established in 2004 at Anand with the support of the Government of Gujarat, Act No.(Guj 5 of 2004) dated April 29, 2004. Caved out of the erstwhile Gujarat Agricultural University (GAU), the dream institution of Sardar Vallabhbhai Patel and Dr. K. M. Munshi, the AAU was set up to provide support to the farming community in three facets namely education, research and extension activities in Agriculture, Horticulture Engineering, product Processing and Home Science. At present there seven Colleges, seventeen Research Centers and six Extension Education Institute working in nine districts of Gujarat namely Ahmedabad, Anand, Dahod, Kheda, Panchmahal, Vadodara, Mahisagar, Botad and Chhotaudepur
AAU's activities have expanded to span newer commodity sectors such as soil health card, bio-diesel, medicinal plants apart from the mandatory ones like rice, maize, tobacco, vegetable crops, fruit crops, forage crops, animal breeding, nutrition and dairy products etc. the core of AAU's operating philosophy however, continues to create the partnership between the rural people and committed academic as the basic for sustainable rural development. In pursuing its various programmes AAU's overall mission is to promote sustainable growth and economic independence in rural society. AAU aims to do this through education, research and extension education. Thus, AAU works towards the empowerment of the farmers.
Browse
Search Results
ThesisItem Open Access Serological detection, Molecular characterization and Management of Chilli veinal mottle virus (ChiVMV) in chilli (Capsicum spp.)(DEPARTMENT OF PLANT PATHOLOGY B. A. COLLEGE OF AGRICULTURE ANAND AGRICULTURAL UNIVERSITY ANAND, 2015) Arade Prashant C; Dr. R. N. PandeyChilli (Capsicum spp.), belongs to the family: Solanaceae, is a herbaceous or semi-woody annuals or perennial plants. Chilli veinal mottle virus (ChiVMV) causes huge yield loss in chilli crop worldwide. It belongs to family Potyviridae which contains viruses with ssRNA encapsidated in flexuous filamentous particles.ThesisItem Open Access SUBACUTE TOXICOPATHOLOGICAL STUDIES OF TAMOXIFEN IN WISTAR RATS(AAU, Anand, 2011) PANCHAL, VIJAY P.; Ghodasara, D. J.The present research work was conducted on 24 male and 24 female Wistar rats to study the toxicoathological effects of repeated dose (28 days) of tamoxifen. Wistar rats were randomly divided into 4 different groups with six males and six females in each group. Animals of group II to IV were given 1, 10 and 20 mg/kg b.wt tamoxifen by oral gavage for 28 days where as group I was administrated only 0.5% CMC as (vehicle) control. After completion of 28 days treatment, blood samples were collected for haematology and serum biochemical analysis from retro-orbital plexus with the help of capillary tube. The animals were sacrificed by high dose of anesthesia with Di - ethyl ether on 29th day for necropsy and collection of tissue. Necropsy examination was performed in all sacrificed animals and gross lesions were recorded. Tissue samples (lung, liver, kidney, intestine, spleen, testes, epididymis, heart, brain and uterus) were collected in 10% formalin solution for histopathological examination. The extent and severity of observed symptoms varied according to the dosage administered to animals. Symptoms like weakness, loss of appetite, aggressiveness and mild alopecia were noticed in rats of high dose group. The dose dependent reduction in body weight and feed consumption were observed in animals of group II, III and IV. The significant decrease in RBC count, packed cell volume, haemoglobin and MCV was recorded in group IV whereas significant increase in total leucocyte count was noticed in group III and highly significant increase in group IV animals. The differential leucocyte count revealed significant increase in neutrophil count in group III and highly significant increase in group rV animals whereas significant decrease in lymphocyte count in animals of tamoxifen treated group IV. No significant change in monocyte, eosinophil and basophil counts were observed in tamoxifen treated groups. AST and ALT values increased significantly in group III and highly significantly in group IV. The significant increase in AKP, creatinine and BUN values were recorded in treatment group IV. The significant decrease in total protein and albumin were observed in treatment group HI and highly significant decrease in group IV. All the rats exposed to tamoxifen at three different dose levels revealed dose dependant pathological changes in group III and IV in different organs. The lesions were characterized by degeneration, necrosis, inflammatory and vascular changes. The main target organs affected were liver, testes and uterus. The overall lesions gave impression that tamoxifen was hepatotoxic as well as toxic to reproductive system. The intensity and distribution of such lesions were more severe in rats of group TV followed by group III.ThesisItem Open Access PHENOTYPIC AND GENOTYPIC IDENTIFICATION AND METAGENOMIC ANALYSIS OF SUBCLINICAL MASTITIC PATHOGENS IN COWS(AAU, Anand, 2011) BHANDERI, BHARAT BABUBHAI; Jhala, M. K.Subclinical mastitis occurs with no visible changes in the appearance of the milk and/or the udder, but milk production decreases which leads to economic losses to the farmers and dairy industry. There are many microbial pathogens involved in causing subclinical mastitis in cows. The present study was undertaken to know incidences of subclinical mastitis in organized farms using Somatic Cell Count (SCC) and bacteriological examination (International Dairy Federation-IDF guidelines), California Mastitis Test (CMT) and impregnated pH strip test followed by characterization and PCR based detection of important mastitic pathogens. Metagenomic analysis of subclinical mastitis milk was also done to determine the complex microbial diversity in udder environment during subclinical mastitis. A total of 349 quarters of 89 lactating cows comprising 31 Triple cross (TP) (Kankrej x Jersey x Holstein Friesian), 29 Kankrej, 17 Gir and 12 Holstein Friesian (HF) affiliated with Anand Agricultural University, Anand were screened for subclinical mastitis. Overall 52.8 per cent (47/89) cows were found to be positive for subclinical mastitis infection in one or more quarters. The highest incidence of subclinical mastitis was found in Triple cross cows (74.19%), followed by Gir cows (58.82%), HF cows (50%) and Kankrej cows (27.58%). Overall quarter wise incidence for subclinical mastitis was found to be 30.66 per cent (107/349). The highest incidence was found in Gir cows (38.80%) followed by Triple cross cows (38.08), HF cows (33.33%) and Kankrej cows (15.04%). The highest incidence of subclinical mastitis was found in fore left quarter (28.03%), followed by hind left quarter (27.1%), fore right quarter (24.29%) and hind right quarter (20.56%). Of the 47/107 cows/quarters positive for subclinical mastitis, 39/47 (82.97%) cows and 82/107 (76.63%) quarters were also positive by CMT and 27/47 (57.44%) cows and 56/107 (52.33%) quarters were positive by impregnated pH strip test. Cultural isolation ft'om 107 subclinically positive quarter milk samples yielded 126 bacterial isolates. Staphylococci was the most predominant bacterial species accounting for 53.97 per cent (68/126) of all the isolates, followed by 21.43 per cent (27/126) CAMP (Christie-Atkins-Munch-Peterson) test positive Str. agalactiae, 18.25 per cent (23/126) Micrococci, 4.77 per cent (6/126) E. coli and 1.58 per cent (2/126) Bacillus species. Out of 68 Staphylococci isolates, 38 (55.89%) isolates showed fermentation on Mannitol Salt Agar (MSA), whereas 30 (44.11%) isolates were mannitol non fermentive. Of the total 30 S. aureus identified by PCR, 21 (70%) were mannitol fermentive and 9 (30%) mannitol non fermentive. Thirty one (45.58%)) Staphylococci were found to be positive for pigment production, whereas 37 (54.42%) isolates produced white colonies on nutrient agar. Forty eight (70.58%) isolates were found positive for coagulase reaction, whereas 20 (29.41%) were negative. Thirty one (45.58%)) isolates exhibited P haemolysin production, 4 (5.89%) a haemolysin and 33 (48.53%)) isolates were non-haemolytic on 5 per cent Sheep blood agar. Phage typing at National Staphylococci Phage typing Centre, Maulana Azad Medical College, New Delhi, using five phage group sets of International Basic Set of 23 phages revealed maximum number of the Staphylococci isolates lysed by group II 14 (82.35%), followed by groups III, Not alloted (NA), I and V with 12 (70.58%), 9 (52.94%), 5 (29.23%) and, 2 (11.76%) respectively. Maximum 11 (64.7%) isolates were lysed with phage number 47 with strong reaction, followed by 10 (58.82%)) isolates with phage numbers 42E and 81, while less effective phage numbers were 71 and 94, which lysed only one strain (5.89% each) and phage number 95 not giving strong reaction with any of the isolates. The methicillin and oxacillin antibiotic sensitivity pattern by disc diffusion method revealed that, all the 68 (100%)) Staphylococci isolates were sensitive. Serotyping of six E. coli isolates (at National Salmonella and Escherichia Centre, Kasauli, Himachal Pradesh for 'O' antigen) resulted in identifying 014, O20, 045, 055 and 0112 serotypes, while one isolate was untypeable (UT). Out of 68 Staphylococci isolates tested for identification of 5. aureus by PCR, 30 isolates were identified as S. aureus by obtaining amplification product of 1318bp using S. aureus specific primer for 23S rRNA. Out of 30 PCR positive S. aureus, 18 (60%)) were positive and rest were negative for coagulase test. All the 27 Streptococci isolates were identified as Str. agalactiae by amplifying 586bp product using Str. agalactiae specific primer for the 16S rRNA while, none were amplified for Str. dysgalactiae (401bp) and Str. uteris (94bp) based on primers specific for the 16S rRNA and 23 S rRNA respectively. All the six E. coli isolates yielded 232bp amplified product using E. coli specific primer targeting DNA sequence coding for the 23 S rRNA. Metagenomic analysis (using GS FLX 454 Life Sciences) of DNA of subclinical mastitis milk sample of TP, Kankrej and Gir cows yielded an out put of 274190 bp, 17,727 bp, 42,548 bp and 1,960, 170, 301 contigs respectively. Average fragment length obtained were 139.89, 104.28 and 141.36 bp for TP, Kankrej and Gir cows respectively. The longest sequence length was 560, 327 and 454 bp, while shortest sequence length was 40, 40, and 41 bp for TP, Kankrej and Gir cows respectively. A total of 54 (2.76%), 39 (22.94%) and 12 (3.99%) sequences for TP, Kankrej and Gir cows respectively could be matched to proteins in SEED subsystems of MG-RAST (Meta Genome Rapid Annotation with Subsystem Technology) (using an e-value cut-off of le-5). Metagenomic analysis of the three breeds identified bacterial organisms belonging to phyla (5), class (8), Subclass / order (15), Family (19), Genus (23) and species (28); of these, 19 genera and 26 species, many of which were fastidious/anaerobic organisms, were identified additionally than the cultural methods. Out of five genera Staphylococcus, Streptococcus, Micrococcus, Bacillus and Escherichia detected in the subclinical mastitis milk samples of TP, Gir and Kankrej breeds by culture based methods, four genera Staphylococcus, Streptococcus, Bacillus and Escherichia were also identified in the corresponding pyrosequencing data, while Micrococcus identified by culture based methods was not found in the pyrosequencing data. In pyrosequencing, over all 28 bacterial species were identified from all the three breeds of cows viz. Leifsonia xyli, Propionibacterium acnes, Streptomyces coelicolor, Chlamydophila abortus, Staphylococcus aureus, Staphylococcus epidermidis, Lactobacillus acidophilus, Streptococcus mitis, Burkholderia cenocepacia, Burkholderia cepacia, Ralstonia solanacearum, Nitrosomonas europaea, Pseudoalteromonas atlantica. Salmonella Dublin, Serratia marcescens, Azotobacter vinelandii, Pseudomonas aeruginosa, Pseudomonas mendocina, Stenotrophomonas maltophilia. Bacillus subtilis, Lactobacillus delbrueckii. Aster yellows witches'-broom phytoplasma, Pannbaculum lavamentivorans, Thermosipho melanesiensis, Aeromonas hydrophila, Escherichia coli, Shigella hoydii and Pseudomonas fluorescens. Of these, except S. aureus and E. coli, all were additionally identified than the culture based method but, Str. agalactiae identified by cultural method was not found in the pyrosequencing data. The role of lesser known or less frequently involved organisms as identified by metagenomic analysis may be further explored in future so as to understand the complete etiopathology of subclinical mastitis in cows.ThesisItem Open Access Application of Real Time PCR assay for quantifying bacterial density in the rumen of Goats fed tannin rich diets(AAU, Anand, 2009) SONI, PRASHANTKUMAR SURESHBHAI; Pandya, P. R.India possess second largest population of Goats. Grazing goats are the backbone of most of the world's marginal land enterprises. They are capable of utilizing effectively a vast variety of plant species and vegetation types including unconventional feeds. Goats are normally habituated to eat vast variety of tree leaves which usually contain anti-nutritional factors like tannins. Their tannin tolerance is higher than other livestock. This may be due to speciaUzed microbial ecosystem. Present study was aimed to explore the effect of tannins on ruminal microbes using real time PCR approach. Tannins are most effective against the fiber-degrading (cellulolytic) bacteria like Fibrobacter succinogens, Riiminococcus species, Butyrivibrio fibrisolvens, Ruminobacter amylophilus. The ruminants which continuously feed upon diets rich in tannins usually develop a microflora which is tolerant to high tannins such bacteria includes Streptococcus capriniis, Streptococcus bovis, Selenomonas ruminantium, Clostridium species and class proteobacteria. The experiment was conducted on eight adult goats divided into 4 groups viz. Tl: control (0% acacia nilotica pods in TMR, 0% tannin), T2: 25% acacia nilotica pods in TMR (3.5% tannin), T3: 43% acacia nilotica pods in TMR (6% tannin) and T4: 59% acacia nilotica pods in TMR (8.5%) tannin). The Total Mixed rations with different levels of Acacia pods were produced and fed to respective goats ad lib. Rumen liquor (200 ml) was collected on 0, 15th and 30th day of experiment at 0, 3 and 6 hrs post feeding from each animal to study the effect of tannins on bacterial population. The bacterial DNA was extracted from pooled samples of both animals in each group by enzyme-chemical lysis method from rumen fluid. The DNA stock samples were quantified using Nano-drop spectrophotometer at 260 and 280 nm. Purity of DNA was judged on the basis of optical density ratio at 260:280 nm which was between 1.8 to 2.0 for all the samples indicating desirable purity. Species specific primers were used to amplify the bacteria (Selenomonas niminantium, Streptococcus bovis, Fibrobacter succinogenes, Treponema bryantii, Anaerovibrio lipolytica, Total Bacteria, Prevotella ruminicola, Ruminococcus albus, Methanobacteriales and Methanomicrobiales targeting 16S rRNA gene were used for amplification of DNA. The amplified products were visualized as a single compact band of expected size under UV light. The PCR products were purified by eluting the PCR product from the agarose using QIAquick Gel Extraction Kit - Qiagen and were ligated in pTZ57R/T vector of InsT/Aclone TM kit (Fermentas). This was followed by transformation into competent cells (DH5-α strain) of E.coli. Recombinant colonies were picked up by Blue white screening. White colonies were confirmed for presence of insert by colony PCR using M13 primers. Recombinant colonies were inoculated in Luria Broth for 16-18 hrs. Plasmid extraction from overnight culture was carried out by using QIAprep plasmid extraction kit. The plasmids contain species specific amplified DNA fragment so these plasmids were used as standards while running the real time PCR. Their copy number was calculated using optical density and molecular weight of plasmids. The plasmids were serially diluted and standard plot was prepared and according to the plot, the concentration of amplified DNA and ultimately the bacterial population was measured. All samples along with standard plasmids were amplified with species specific primers using real time PCR. The population of bacteria Selenomonas ruminantiwn increased with increase in level of tannins in different group (1314% increase in group IV followed by 747% and 210%) in group III and II respectively at 30th day of experiment) of animals and also with period of experimentation (Increased with 844%) and 1314% at 15th and 30th day respectively in group IV). Similarly the population of Streptococcus bovis also increased with increase in level of tannins and with period of feeding (555%o increase in group IV at 30th day). The lipolytic bacteria Anaerovibryo lipolytica increased with increase in level of tannins in feed (3645% increase in group IV). The results revealed Selenomonas ruminantium and Streptococcus bovis as tannin tolerant bacteria. Tarmins have inhibitory activity against fibrolytic bacteria Fibrobacter succinigenes and reduction in population was more prominent at 30th day of experiment (decreased by 73%, 67%) and 57% in group FV, III and II respectively). Similar inhibitory effect (78% decrease in group IV) was also seen in Treponema bryantii which is saccharolytic spirochete and has been shown to be associated with the fibrolytic bacteria of the rumen. The population of proteolytic bacteria Prevotella niminicola was not affected at any level of tannins throughout the experiment. At low level (3.5%), tannins have beneficial effect on microbial growth for total bacterial population but no effect was seen at other levels. The population of methanogens of the order Methanobacteriales and Methanomicrobiales also remain unchanged even at the highest level of tannins. The population of Ruminococcus albus increased at 15th day with the highest in group FV (496%) followed by group III (416%) and group II (308%). At 30th day the population decreased compared to 15th day but remained at higher level to that of 0 day population. The study revealed that Selenomonas ruminantium, Streptococcus bovis and Anaerovibrio lipolytica are major tannin tolerant bacteria in goats. Tannins exert detrimental effect on fibrolytic bacteria like Fibrobacter succinigenes and Treponema bryantii. However no effect of dietary tannins was observed on Prevotella ruminicola, Methanogenes (Methanobacteriales and Methanomicrobiales) and total bacterial population in goats.ThesisItem Open Access SINGLE NUCLEOTIDE EXTENSION ASSAY FOR CHARACTERIZATION OF DGAT1 LOCUS IN MEHSANA BUFFALO(AAU, Anand, 2009) PATIL, RAHUL CHAITRAM; Joshi, C. G.India, home ground of water buffalo (Bubalus bubalis) has 11 recognized breeds adapted to different climatic zones. The immense importance of this species due to contribution of more than 55 per cent to the total milk production and making country as number one milk producer in the world. Tremendous variation in production traits provokes buffalo genomic research to identify genes underlying the variability of milk production traits that could be useful in effective breeding programs. Present study was carried out with enormous interest in genotyping of Diacylglycerol acyltransferase 1 (DGATl) locus of Mehsana buffalo. The DGATl gene plays crucial role in triglyceride synthesis in the mammary gland which is proved by mice lacking both copies of DGATl gene are completely devoid of milk secretion and became a functional candidate gene for lactation traits. In the present study, five SNPs of DGATl gene of Indian water buffalo (GenBank-accession number DQ886485) with nucleotide position 1179, 1195 and 3096 (intron 1), 5545 (intron 2) and 6067 (intron 3) were selected for screening 64 Mehsana buffalo samples with the help of single nucleotide extension assay. According to principle of assay, unlabeled primers are hybridized to the DNA template just adjacent to respective SNP site and primer is extended by one base by DNA polymerase with fluorescence-labeled ddNTP terminators and further separated by capillary electrophoresis. Genomic DNA samples of Mehsana buffalo were subjected to DGATl specific PCR amplification using appropriate primer pairs and PCR products of expected size were successfully amplified at annealing temperature dO^C and then electrophoresed on 2 per cent agarose along with the MassRular Low range DNA ladder. Purified PCR products were subjected to single nucleotide primer extension with respective target DNA template and optimized under thermal cycling condition of armealing at 60°C and extension at 65°C for 25 cycles. Along with test samples, positive and negative control was also processed. All the SNaPshot PCR products then treated with CIAP and subjected to capillary electrophoresis on ABI PRISM 310 Genetic Analyzer along with LIZ 500 size standard for further analysis. The type of nucleotide present confirmed by the signal colour observed and length of final product obtained, by comparing with the size standard. The final length of each test primer extension product was judged by repeatedly running a single primer reaction and then determined consistently observed length of particular primer. Further (multiplex SNaPshot reaction was carried out using multiple primers with optimum concentration to determine the position and type of SNPs in single reaction. All the samples were found homozygous in both groups for SNP 1179, 1195 and 3096 with genotype AA, CC and CC respectively. This indicated that these alleles were fixed. Both the variants at nucleotide position 5545 (C and T) and 6067 (T and C) were observed. Allelic frequency was checked for both these SNPs and were found 0.85 (CC) and 0.15 (TT) for SNP 5545 while 0.57 (CC) and 0.43 (TT) for SNP 6067. Statistical analysis showed no significant association of these five SNPs with milk production traits like milk yield and milk fat percentage. All studied SNPs belonged to intronic regions however, may not be involved in manifestation of the traits.ThesisItem Open Access Diversity and molecular characterization of ruminal bacterial flora of goats(AAU, Anand, 2009) Patel, Jayesh M.; Jhala, M. K.Rumen harbors diverse types of microbes mainly bacteria followed by protozoa, fungi and yeast. Bacterial population as high as 10 power 10 is found in rumen and has a profound effect on nutritional and physiological processes in the host. Much of the pioneering studies on the rumen microbiota are based on microscopic examination and anaerobic culture techniques. But the polymiorphic nature and the difficulty of cultivating the microbes have hampered effective assessment of ruminal ecology by these methods. Newer molecular approaches are available to identify and characterize the bacteria that are based on detecting highly conserved 16S rRNA gene regions. Molecular characterization of rumen microflora in Indian goat apparently has not been carried out yet. Present study was aimed to determine diversity and molecular characterization of ruminal bacterial flora of goats using 16S r RNA gene amplification, cloning and sequencing of gene followed by phylogenetic analysis. Five goats reared at Instructional farm managed by Livestock production and management department at College of Veterinary Science and AH., Anand, were used for rumen liquor collection using a flexible stomach tube. The bacterial DNA was isolated from strained rumen liquor following enzyme-chemical lysis method The quality and quantity of DNA stock sample was determined using Nano-drop spectrophotometer and agarose gel electrophoresis. Universal primers for bacteria 27F (5'AGAGTTTGATCCTGGCTGGCTCAG 3') and 1492R (5' GGTTACCTTGTTACGACTT 3') targeting 16S rRNA gene were used for amplification of DNA. The amplified product was visualized as a single compact band of expected size (1346 bp) by gel documentation system. PCR product was subsequently eluted from agarose gel and ligated in pDrive vector followed by transformation into competent E. coli (DH5-a strain) cells. White recombinant colonies were selected (n=102), revived on fresh plates and screened for expected insert by colony PCR. Clones showing the amplification of 1346 bp DNA fragment were considered as positive clones (n=73) carrying desired insert of 16S rRNA gene. Screened products of colony PCR were subjected to Restriction Fragment Length Polymorphism (RFLP) analysis by Haelll and clones with common banding pattern were removed (n= 12) and remaining colonies (n=61) were used for plasmid extraction. The concentration of the plasmid was determined and was subjected to automated DNA sequencing on ABI PRISM® 310 Genetic Analyzer (Apphed Biosystems, USA) using BigDye® Terminator v3.1 Cycle sequencing kit. Sequences with good quality value (n=60) were selected for further analysis. Sixty sequences of good integrity were subjected to in silico processing by three ways viz. Similarity search using MEGA BLAST at NCBI nucleotide database, Taxonomic classification by Ribosomal Database Project (RDP) and Phylogenetic analysis. Out of 60 clones, 46 clones (77%) showed similarities in the range of 95-99%, nine clones (15%) in range of 90-94% and five clones (8%) showed less than 90% (of which four clones falling between 85-89%) similarities with NCBI nucleotide database. Five clones (8%) showed similarities with known bacterial species (viz. Ruminococcus albus, Ruminococcus flavefaciens, Prevotella multiformis {2 clones} and Butyrivibrio fibrisolvens), five clones (8%) showed similarities with known bacterial genera (viz., Ruminococcus, Prevotella, sad Bacillus {3 clones}). Taxonomic classification by RDP revealed that 60 clones were mainly distributed into two phyla, namely Bacteroidetes with 21 (35.0%) clones, Firmicutes with 20 (33.0%) clones, 17 (29%) clones fell under unclassified bacteria and two (3%) clones were grouped under unclassified root. Phylogenetic analysis using neighbour-joining method revealed three clones (5%) out of 60 as spp, two clones (3%) as genera, one clone (1.6%) as family and 27 clones (45%) as imcultured/unidentified rumen bacteria. Remaining 27 clones (45%) appeared to be novel, which showed distinct genetic grouping than the other reported sequences in the database. All the sequences were submitted to GenBank and are available with the accession numbers FJ970656 to FJ970715 in EMBL, GenBank and DDBJ Nucleotide Sequence Databases.ThesisItem Open Access CLINICAL STUDIES ON EPIDEMIOLOGY PATHOLOGY, DIAGNOSIS AND MANAGEMENT OF DOWNER COW SYNDROME(AAU, Anand, 2009) PATEL, BHAVIKA RAMESHBHAI; Patel, P. R.The downer cow syndrome is an emerging problem in high yielding cows. Management of such downer cows becomes a most challenging problem for any veterinarian. Downer cow syndrome is an extensively studied phenomenon all over the world but meager information has been reported in India. The present work on "Clinical Studies on Epidemiology, Pathology, Diagnosis and Management of Downer Cow Syndrome" was undertaken during the period starting from 1st October 2008 to 15th May 2009 in and around Anand town (Gujarat) to study the epidemiology and clinical management of downer cow syndrome. A total of 2,242 cows were at risk for downer cow syndrome, out of which 48 cows (2.14%) were found to be showing definitive signs of downer syndrome. Out of 48 downer cows, the highest incidence was recorded in more than a week recumbent downer cows (21 cases; 43.8%) followed by five days (11 cases; 22.9%), three days (10 cases; 20.8%) and one day (6 cases; 12.5%)). Out of 48 cases of downer cows syndrome, the incidence was recorded to be highest in Jersey crossbred (25 cases; 52.0%), followed by Holstein Friesian crossbred (15 cases; 31,2%), pure Holstein Friesian (5 cases; 10.4%), non -descript (2 cases; 4.2%) and pure Jersey (1 case; 2.0%). Out of 48 cases of downer cow syndrome, the highest incidences was recorded in high milk producers (23 cases; 48%), followed by average milk producers (22 cases; 46%)) and low milk producers (3 cases; 6%). Out of 48 cases of downer cow syndrome, the incidence was recorded to be highest in third and fourth lactation (22 cases; 46.2%)), followed by second lactation (10 cases; 20.7%), first lactation (9 cases; 18.5%), sixth lactation (5 cases; 10.5%) and fifth lactation (two cases; 4.1%). Type of housing and hygienic condition was not found to be correlated with the incidence of downer cow syndrome. Majority of the cows suffered from downer syndrome around calving or within a month post parturition. However, cases also occurred in late lactation, advance pregnancy and other physiological states. Downer cows were found into two categories clinically alert downers (41 cases; 85.4%) and non alert downers (7 cases; 14.6%). The alert downers were bright and alert with normal or slightly reduced appetite. The body temperature, rumination, urination and defecation were normal. The heart and respiratory rates were normal except few cows which had accelerated heart and respiratory rates (12 cases; 29.2%). Such cows tried to get up from front but were unable to raise their hind quarters. Characteristic crawling was also observed in fourteen (31.1%)) downer cows. The non-alert downers preferred lateral recumbency and they were completely anorectic with accelerated heart and respiratory rates. Haematologically, the downer cows had significantly (p<0.05) decreased Hb (7.90 ± 0.45), PCV (24.65 ± 1.26) and TEC (4.77 ± 0.15). Whereas significant (p<0.05) increased MCV (62.43±1.25), decreased MCHC (27.61 ±1.30), relatively neutropliiiia (44.12±1.97) and lymphopenia (52.83±2.12). The concentration of blood glucose (104.14 ± 6.57), BUN (20.00 ± 1.89) and creatinine (3.62 ± 0.53mg/dl) were significantly higher in downer cows. The activities of serum enzymes like AST (196.95 ± 19.41), ALT (57.41±7.84), CPK (14.93±1.07) and LDH (503.91 ±6.42) were significantly (p<0.05) higher in downer cows. Downer cows had significantly (p<0.05) low calcium (7.58±0.26), phosphorus (3.84±0.13), magnesium (2.82±0.09) and potassium (3.15±0.18) concentration. Majority of downer cows suffered from net deficiency of calcium, phosphorus, potassium and magnesium while some had combined deficiency. The Cortisol level (151.00±0.48) significantly (p<0.05) elevated in downer cow syndrome. Histopathologically, necrosis of muscle, demyelinization as well as loss of axon of nerves and degenerative changes in heart, liver, and kidney were characteristic features. In order to understand and formulate suitable diagnosis and therapeutic measures; clinical symptoms, haematology, biochemical profile, enzymes, minerals and electrolyte were studied on 48 cows suffering form downer cow syndrome. With combined therapy consisting of calcium, phosphorus, magnesium and nervine stimulant at parenteral route with manual change of sides, massage of limbs and lifting of animals manually or with the help of sling on two-three occasions a day, success could be gained in 52 per cent downer cows (25 out of 48). The downer thus treated showed clinical recovery within a period of 3-40 days.ThesisItem Open Access EFFECT OF DIFFERENT CATEGORIES OF SERA AND BOVINE SERUM ALBUMIN ON IN VITRO MATURATION OF SURTI BUFFALO OOCYTES(AAU, Anand, 2009) MISTRY, CHIRAG NATAVARLAL; Dhami, A. J.This study was conducted over a period of 6 months from September 2008 to February 2009 with the objectives of evaluating the effects of different concentrations (0.05, 0.1, 0.3, 0.6 and 0.9 per cent) of BSA-FAF and also of different categories of sera like Fetal Calf Serum (Gibco), Fetal Buffalo Serum, Oestrus Buffalo Serum, Postoestrus Buffalo Serum and Anestrus Buffalo Serum (all @ 20%) in relation to standard BSA (0.6%) on in vitro maturation of buffalo oocytes in TCM-199 medium. The rate of maturation was confirmed both by cytoplasmic and nuclear maturation using Hoechst stain 33342. A total of 456 ovaries of Surti buffaloes collected from the local slaughter house were transported to the laboratory at 30°C in normal saline solution within I72 hours of slaughter of animal for further processing. In all 1409 oocytes were recovered from them by using slicing method of surface follicles. The sera samples used for culture were obtained from the animals showing different stages of oestrous cycle and were heat inactivated in the laboratory. An average number of follicle of small, medium and large size found per ovary was 0.82, 0.48 and 0.24, respectively, with an overall mean of 1.55. The distribution of these follicles came to 53.18, 31.12-and 15.70 percent, respectively. The slicing method of oocyte recovery gave quite good result. The average oocyte recovery was 3.09 per ovary. The average recovery rate of Grade A, Grade B and Grade C oocyte was 1.02,1.22 and 0.85, respectively. The maturation rate with 0.05, 0.1, 0.3, 0.6 and 0.9 per cent concentration of BSA in TCM-199 was found to be 44.52, 50.99, 59.02, 84.43 and 64.29 per cent, respectively. The BSA 0.6 per cent yielded the highest maturation rate, which differed significantly from other BSA concentrations. The maturation rate for locally prepared FOBS, AnBS, FCS (Gibco), FBS and OBS was found to be 64.63, 54.55, 70.63, 60.48 and 78.16 per cent, respectively. The medium containing oestrus buffalo serum yielded significantly higher (P<0.05) maturation rate than the others, though it was little less than the BSA 0.6. The highest maturation of Grade A oocytes was found in BSA 0.6 followed by OBS and other sera. While in Grade B it was in BSA 0.9 followed by BSA 0.6, and for Grade C oocytes the highest maturation rate was with BSA 0.6 followed by FOBS. According to nuclear maturation, the highest number of oocytes with germinal vesicle was found in medium containing FBS (25.21 %) followed by AnBS and others. The highest number of germinal vesicle break down was found in FOBS (30.61 %) followed by FCS (Gibco) and others. The higher number of oocytes with Metaphase-I was in the medium containing BSA 0.6 per cent (22.13 %) followed by FCS (Gibco), while, the Metaphase-II stage was found to be higher in medium containing OBS (41.38 %) followed by BSA 0.6 and others. Degenerated oocytes were maximum with BSA 0.05 per cent (40.41 %) and minimum with OBS (9.20 %). It was concluded that BSA concentration of 0.6 per cent is the optimum for in vitro maturation of buffalo oocytes, and that OBS can be used instead of BSA as a cheaper and easily available source of serum for in vitro maturation of buffalo oocytes.ThesisItem Open Access STUDIES ON EFFECT OF KETOPROFEN AND FEBRILE CONDITION ON PHARMACOKINETICS OF LEVOFLOXACIN AND SAFETY OF LEVOFLOXACIN ALONE AND IN COMBINATION WITH KETOPROFEN IN SHEEP(AAU, Anand, 2009) PATEL, URVESHKUMAR DAHYABHAI; Thaker, A. M.Levofloxacin is a novel third generation fluoroquinolone with broad spectrum antibacterial activity. Use of non-steroidal anti-inflammatory drugs (NSAIDs) are frequently recommended with antibacterials for the treatment of various bacterial infections accompanied by fever and other inflammatory conditions in animals. Ketoprofen (KTP) is an aryl propionic acid derivative, non-selective COX inhibitor NSAID having anti-inflammatory, analgesic and antipyretic properties. In veterinary practice, ketoprofen is used to lower body temperature in animals having fever, to relieve bacteremia and pain in all animals. Pharmacokinetics of an antibacterial drug may change when administered with anti-inflammatory drug or in febrile animals. Despite the great potential for clinical use of levofloxacin, the data on its pharmacokinetics and safety profile in sheep are scarce. The present study was planned to determine the effect of intramuscularly administered ketoprofen (3 mg/kg) and febrile condition (lipopolysaccharide (LPS) induced) on pharmacokinetics of levofloxacin following intravenous, subcutaneous and oral administration (3 mg/kg) in sheep and safety of daily intravenous administration of levofloxacin alone (3 mg/kg) and in combination with intramuscular administration of ketoprofen (3 mg/kg) for five days in sheep by monitoring haematological and blood biochemical profiles.