Loading...
Thesis
Browse
10 results
Search Results
ThesisItem Unknown MOLECULAR IDENTIFICATION AND MANAGEMENT OF FUSARIUM WILT PATHOGEN IN CHRYSANTHEMUM (Dendranthema grandiflorum Tzelev)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA - 516 105, Y.S.R KADAPA DISTRICT, ANDHRA PRADESH, 2019-07-08) N. UMALATHA; Dr. CH. RuthThe present investigation entitled ʽʽMolecular identification and management of Fusarium wilt pathogen in chrysanthemum (Dendranthema grandiflorum Tzelev)ʼʼ was carried out at College of Horticulture, Anantharajupeta during the year 2018-2019. A roving survey was conducted to record Fusarium wilt incidence under field conditions in Kadapa, Chittoor, Ananthapuramu and Kurnool of Andhra Pradesh (A.P.). The maximum mean disease incidence was observed in Kadapa district (24.68%) followed by Chittoor district (19.85%), Ananthapuramu district (15.78%), whereas, minimum mean disease incidence was observed in Kurnool district (6.95%). The wilt pathogen of Fusarium oxysporum f. sp. chrysanthemi was isolated from collar region of infected chrysanthemum plant and their pathogenicity proved. Based on cultural and morphological characters, of isolates were identified as Fusarium oxysporum f. sp. chrysanthemi (NCFT, 9374.18) and confirmed by National Centre for Fungal Taxonomy (NCFT), New Delhi. Molecular characterization was conducted for Fusarium oxysporum f. sp. chrysanthemi. For identification of pathogen at molecular level, the genomic DNA was amplified with universal primes ITS 1 (TCCGTAGGTGAACCTGCGG) and ITS 4 (TCCTCCGCTTATTGATATGC). From the results obtained, the genomic DNA amplified at a 562 bp. Sequences were analysed through NCBI-BLAST programme database search system. BLAST (mega blast) analysis for sequence similarity of ITS rDNA region confirmed the identity of the pathogen. Sequence was deposited in NCBI, the Accession number (MK956193) for that sequence. Phylogenetic tree was constructed by using neighbour-joining method and maximum likelihood for the ITS regions. Results from the BLAST (Mega blast) data base showed, that the studied isolate have 98% similarity with Name of the author : N. UMALATHA Title of the thesis : ʽʽMolecular identification and management of Fusarium wilt pathogen in chrysanthemum (Dendranthema grandiflorum Tzelev)ʼʼ Degree to which it is submitted : M.Sc. (HORTICULTURE) Faculty Department : : HORTICULTURE PLANT PATHOLOGY Major Advisor : Dr. Ch. RUTH University : Dr.Y.S.R. HORTICULTURAL UNIVERSITY Year of submission : 2019 Fusarium oxysporum (Genbank KJ082096.1) and Fusarium sp. (Genbank ID - KU612374.) Rhizosphere antagonists (Bacteria, fungi and actinomycetes) were isolated from healthy rhizosphere soil samples collected from Kadapa, Chittoor, Ananthapuramu and Kurnool of Andhra Pradesh (A.P.). A total of 25 rhizosphere microbes were isolated. Among these, 20 isolates, seven fungi (RFA1 Phoma glomerata, RFA2 Aspergillus niger strain 1 RFA3 Aspergillus fumigates, RFA4 Aspergillus niger strain2 , RFA5 Aspergillus nidulans, RFA6 Aspergillus flavus strain 1, RFA7 Aspergillus flavus strain 2 ) three bacteria (RBA1 Bacillus cereus, RBA2 and RBA3) and three actinomycetes (RA1Streptomyces griseus, RA2 Streptomyces griseolus and RA3 Streptomyces griseoflavus)were found to exhibit antagonism against chrysanthemum wilt pathogen. Molecular identification of effective rhizosphere bacterial antagonists (RBA1) was conducted by the use of primers, 27F(AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTTS) the bacteria were identified as Bacillus cereus which have amplified at 874 base pairs. They were sequenced and the sequenced nucleotides were compared against Gen Bank database using the NCBI BLAST algorithm, the BLAST results shown the 88% similarity of the isolate (RBA 1) with Bacillus cereus. Among the rhizosphere antagonistic fungi, recorded highest inhibition over control, RFA 5- Aspergillus nidulans (84.68%), bacterial antagonist RBA 1- Bacillus cereus (65.88%) and rhizospheric actinomycetes RA1- Streptomyces griseus (70.74%) were more antagonistic against F.oxysporum f. sp. chrysanthemi respectively. An in vitro experiment was conducted on Fusarium oxysporum f. sp. chrysanthemi with five fungicides, viz., Copper oxy chloride 50% WDP, Carbendazim 12% + Mancozeb 64% WP, CuSO₄ + Lime + Water (Bordeaux mixture), Thiophanate methyl, Difenconazole 25% EC for their inhibitory effect. Among the fungicides, tested against pathogen Carbendazim + Mancozeb concentration (0.1% 0.2% 0.3%) and Difenconazole at (0.2%) showed 100 per cent inhibition against Fusarium wilt pathogen. The compatibility of the effective rhizosphere fungal antagonist Aspergillus nidulans (RFA 5) and effective rhizosphere bacterial antagonist Bacillus cereus (RBA1) to five fungicides viz., Copper oxy chloride 50% WDP, Carbendazim 12% + Mancozeb 64% WP, Bordeaux mixture, Thiophanate methyl, Difenconazole 25% EC were assessed. Copper oxychloride (0.3%) and Bordeaux mixture (0.5%) are more compatible with Aspergillus nidulans and Carbendazim 12% + Mancozeb 64% WP, Thiophanate methyl, Difenconazole 25% EC were compatible with Bacillus cereus. The most effective treatments proved effective under in vitro studies were tested against Fusarium oxysporum f. sp. chrysanthemi under pot culture conditions. Among the six treatments, recorded lowest disease incidence in the treatment T1- soil application of Streptomyces griseus (27.00%) and T2 - soil application of Streptomyces griseolus (27.25%) were the most effective antagonists respectively.ThesisItem Unknown STUDIES ON ENDOPHYTIC MICROORGANISMS AND THEIR ANTAGONISTIC EFFECT ON SOIL BORNE PATHOGENS IN ACID LIME (Citrus aurantifolia Swingle)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA -516 105, YSR KADAPA DISTRICT ANDHRA PRADESH, 2019-07-08) G. RAZIA SULTHANA BEGUM; Dr. B. GOVINDA RAJULUA roving survey was conducted in total 16 fields belonging to four mandals of Nellore and Kadapa districts of Andhra Pradesh, to know the incidence of root rot diseases in acid lime orchards. The root rot disease incidence was found to be high in Rapur mandal (8 per cent) followed by Podalakur mandal (5.8 per cent) of Nellore district. The incidence of root rot diseases was low in Kadapa district (3.59 per cent) comparatively. Among all the root rots, dry root caused by Fusarium solani was the major problem for the decline of citrus in the surveyed areas and hence the work was continued on the dry- root rot causing pathogen. The dry root rot pathogen Fusarium solani was isolated from the infected roots, based on cultural and morphological characters, the pathogen was confirmed by National Centre for Fungal Taxonomy (NCFT) as Fusarium solani (9624.19). A total of 6 fungal (EFA 1-6) and 8 bacterial (EBA 1-8) endophytes were isolated from roots of healthy plants. Name of the author : G. RAZIA SULTHANA BEGUM Title of the thesis : Studies on endophytic microorganisms and their antagonistic effect on soil borne pathogens in acid lime. (Citrus aurantifolia Swingle). Degree to which it is submitted : M.Sc. (Horticulture) Faculty Major field : : HORTICULTURE PLANT PATHOLOGY Chairman of advisory committee : Dr. B. GOVINDA RAJULU University : Dr. Y.S.R. HORTICULTURALUNIVERSITY Year of submission : 2019 On further in vitro evaluation, EFA 4 (66.92%) and EBA 7 (63.42%) had shown antagonistic activity on Fusarium solani by dual culture method. The compatibility experiments were conducted with 7 fungicides for the effective endophytic antagonists and the results revealed that, the endophytic fungal antagonist, EFA 4 was almost compatible with mancozeb 75% at 0.1% and 0.2%, fosetyl Al 80% at 0.1% and 0.2%, mancozeb 64% + metalaxyl-M 4% at 0.1% and 0.2% and was completely incompatible with carbendazim 50%, copper oxychloride 50% and carboxin 37.5% + thiram 37.5%. The endophytic bacterial antagonist, EBA 7 was compatible with almost all the tested fungicides. The effective endophytic antagonists were further characterized at molecular level. The fungal and bacterial antagonists, EFA 4 and EBA 7, was identified as Aspergillus fumigatus and Pseudomonas aeruginosa. A phylogenetic tree was constructed for the identified endophytic antagonists to find homology with other relevant species.ThesisItem Unknown ORGANIC MANAGEMENT OF PURPLE LEAF BLOTCH OF ONION CAUSED BY Alternaria porri (Ellis) Cif.(COLLEGE OF HORTICULTURE ANANTHARAJUPETA - 516 105, Y.S.R KADAPA DISTRICT, ANDHRA PRADESH, 2019-08-03) KUDIPUDI SAIRAM; Dr. K. GOPALThe present investigation entitled “Organic management of purple leaf blotch of onion caused by Alternaria porri (Ellis) Cif.” was carried out at College of Horticulture, Anantharajupeta during 2018-19. Onion is one of the most important commercial vegetable crops of India. Onion has manifold uses as spice, vegetable, salad dressing etc, hence it is known as “queen of kitchen”. It is also used as condiments for flavouring a number of food and medicines. The crop is subject to attack by a number of diseases, of which purple blotch caused by Alternaria porri is serious and also a major limiting factor in cultivation of onion. With the rising vegetable consumption within the country and the emphasis laid on export of vegetables, there is greater need to increase the production of vegetables. Apart from this, as a result of increasing health consciousness among the people and strict norms in the export of vegetables in recent years, the focus has been shifted in finding out safer alternatives to chemical fungicides in managing the plant diseases. Organic management of plant pathogens is a potential, eco-friendly and a sustainable approach apart from being a promising alternative to the use of chemicals. Present investigation was carried out with objectives viz., in vitro studies on isolation of pathogen and evaluation of antagonists, botanicals and organic amendments against the pathogen. Further, experiment in field condition was carried out to study the management of purple leaf blotch of onion through effective organics and plant extracts obtained from the lab conditions. All fungal antagonists found antifungal / antagonistic in vitro against the test pathogen. Trichoderma harzianum was found most effective with significantly highest mycelial growth inhibition (54.84%) of the test pathogen followed by T. Name of the author : K. Sairam Title of the thesis : Organic management of Purple leaf blotch of onion caused by Alternaria porri (Ellis) Cif. Degree to which it is submitted : M.Sc. (Horticulture) Faculty Department : : HORTICULTURE Plant Pathology Major Advisor : Dr. K. Gopal University : Dr.Y.S.R HORTICULTURALUNIVERSITY Year of submission : 2019 viride (44.72%) and TCT4 (42.19%). Least inhibition was noticed in Penicillium chrysogenum (27.42%). Among the plant extracts maximum inhibition of mycelial growth of A. porri was recorded with Neem leaf extract (44.32%) followed by Glyricidia leaf extract (40.23%). Among the organic amendments tested against A. porri, Panchagavya was proved most effective and recorded the highest reduction of mycelial growth (30.30%) followed by N.S.K.E (26.50%). Regarding to symptoms of expression initial stages, leaves were with circular to oval water-soaked areas which later on, as the disease progressed, became oblong and a fresh zone of discoloured tissue was formed around the spots. Initially spots were white, but later turned pinkish or purple. The change in colour started from the center and gradually progressed towards the periphery, where it changed into light purplish. The transition of colour was marked by concentric rings clearly visible to the naked eye. The older leaves were more susceptible than younger leaves and were relatively more susceptible when they reach close to bulb maturity. In all the treatments initial disease symptoms have appeared after 69 DAP. in vivo studies on organic management of purple leaf blotch of onion revealed that lowest per cent disease index (19.54%) was recorded in T1 (seed treatment with T. harzianum @ 8g kg-1 + spray of Panchagavya 10%) found most effective and followed by T2 (Seed treatment with T. harzianum @ 8g kg-1 + Neem leaf extract 10%- spray) with 20.67 per cent disease index. Regarding to the bulb yield, highest bulb yield of 6,680 kg ha-1 was recorded in T1 (Seed treatment with T. harzianum @ 8g kg-1+ spray of Panchagavya 10%) followed by T2 (Seed treatment with T. harzianum @ 8g kg-1 + spray of Neem leaf extract 10%) 5,580 kg ha-1 . With respect to AUDPC the results indicated, lowest AUDPC in T1 (Seed treatment with T. harzianum @ 8g kg-1 + spray of Panchagavya 10%) 1243.28 followed by T2 (Seed treatment with T. harzianum @ 8g kg-1 + Neem leaf extract 10%- spray) with 1264.61. Regarding to r-value (rate of infection) the results indicated lowest r- value recorded in T1 (Seed treatment with T. harzianum @ 8g kg-1 + spray of Panchagavya 10%) 0.01. Among these treatments highest r- value recorded in recorded in T5 (Seed treatment with T. harzianum @8g kg-1 ) with 0.03. Considering benefit cost ratio, among different treatments the most economical treatment which recorded highest BCR in T1 (Seed treatment with T. harzianum @ 8g kg-1 + spray of Panchagavya 10%) with (1:3.62), which was followed by T2 (Seed treatment with T. harzianum @ 8g kg-1 + Neem leaf extract 10%- spray) with (1:3.16).ThesisItem Unknown MOLECULAR CHARACTERIZATION AND TRANSMISSION STUDIES OF BEGOMOVIRUS INFECTING RIDGE GOURD (Luffa acutangula L.)(COLLEGE OF HORTICULTURE, ANANTHARAJUPETA - 516 105, YSR KADAPA DISTRICT, ANDHRA PRADESH, 2018-07-28) BIKASH CHANDRA SARANGI; Dr. K. GopalToLCNDV.RG of ridge gourd caused by begomovirus is a major constraint in ridge gourd cultivation in Andhra Pradesh and Odisha. The survey under taken during 2017-2018 to assess the incidence of ToLCNDV.RG in ridge gourd and in two districts of Andhra Pradesh and one district of Odisha, revealed that the occurrence of the disease in the range of 20.00 to 75.00 per cent in ridge gourd . Among the districts surveyed, highest disease incidence recorded in Chittoor district (62.11%), followed by Puri (50.99%) and Kadapa district (36.77%). ToLCNDV.RG was successfully transmitted through Bemisia tabaci whitefly which were given 12 h of Acquisition access period (AAP) and incubation period. Ten adult Bemisia tabaci whiteflies were sufficient to cause 100 % transmission and the whitefly retained the infectivity up to be 6-9 days. ToLCNDV.RG was successfully transmitted to bottle gourd and bitter gourd through Bemisia tabaci whitefly vector. The virus causing yellow mosaic disease was identified by PCR amplification of the Coat protein (CP) gene of the virus using CP specific primers. Based on the high level of nucleotide sequence similarity of the viral CP gene, the virus causing yellow mosaic disease in ridge gourd is identified as strain of ToLCNDV. DNA-A had nucleotide identity of 90.4 to 98.9% with Tomato leaf curl New Delhi virus (ToLCNDV) and 59.4 to 86.6% with other xiv begomoviruses and DNA-B had nucleotide identity of 75.6 to 84.4% with Tomato leaf curl New Delhi virus (ToLCNDV) and 31.4 to 79.5%. with other begomoviruses. The complete nucleotide sequences of DNA-A of ridge gourd isolate was determined. The length of DNA-A molecules was 2740 nt comprising of 43.98% GC content, 56.02% AT content with molecular mass of 1662877 daltons. When nucleotide sequences and predicted amino acid sequences of inferred protein of RG isolate was compared with other begomoviruses, ORF AV2 was showing highest identity of nt 99.7 % and 100% amino acid identity with ToLCNDV.RG1 (KT426903) and 93.8 to 99.4% nt and 86.6 to 100% aa homology with ToLCNDV isolates where as with other begomoviruses it has 55.5 to 94.3% nt and 41.1 to 90.1% aa homology. The complete nucleotide sequences of DNA-B of ridge gourd isolate was determined. The length of DNA-B molecules was 2699 nt comprising of 41.39% GC content and 58.61% AT content. The ORF BV1 encoded the nuclear shuttle protein (NSP), has 73.8 to 87.2% nucleotide and 82.7 to 92.9% aa identity with ToLCNDV isolates and 36.7 to 85.2% nt and 23.3 to 85.4% aa identity with other begomoviruses. To determine the genetic variation, the sequences were analysed using Bioedit software. The multiple alignment of seven isolates with ToLCNDV isolates and known other begomoviruses has indicated considerable variation and there is 93.9 to 100% nucleotide similarity among the RG isolates. The isolate MKMD2240.RGCS1 has nucleotide identity of 90.3 to 97.5% with ToLCNDV isolates and 50.2 to 89.1% nucleotide identity with other begomoviruses. The length of the IR sequence is 275 nt which is similar to other isolates infecting ridge gourd. Comparison of IR sequences with ToLCNDV isolates revealed nucleotide identity of 85.0 to 97.0 % and 29.5 to 77.1% with other begomoviruses. Phylogenetic analysis for RG isolate of ToLCNDV was compared with DNA- A nucleotide sequences of 30 ToLCNDV isolates and 17 begomoviruses which are well characterized. Sequence and phylogenetic analysis of both DNA A and DNA-B components showed that the begomovirus associated with ridge gourd yellow mosaic disease is found to be strain of ToLCNDV.ThesisItem Unknown MOLECULAR CHARACTERIZATION AND IDENTIFICATION OF RESISTANT SOURCES TO Tomato Mosaic Virus (ToMV) IN TOMATO(COLLEGE OF HORTICULTURE ANANTHARAJUPETA-516 105, Y.S.R. DISTRICT, ANDHRA PRADESH, 2018-08-10) P. LOKESH BABU; Dr. M. Krishna ReddyThe present study entitled “Molecular characterization and identification of resistance sources to Tomato mosaic virus (ToMV) in Tomato” was conducted at Division of Plant Pathology, ICAR-IIHR, Hesaraghatta, Bengaluru during 2017-18. The tomato (Solanum lycopersicum L.) is a member of solanaceae family which is more proned to viral diseases. Among them, the tomato leaf curl and tomato mosaic are destructive diseases of tomato in India. The mosaic disease in tomato was identified to be caused by Tobacco mosaic virus (TMV) and Tomato mosaic virus (ToMV) is considered to be a strain of TMV until it is proposed as a distinct species in 1971. In the present investigation, an effort has been made to study the incidence of ToMV disease and identification of its causal strain of virus, molecular characterization and identification of resistance sources in tomato. A survey was conducted in major tomato growing districts of Andhra Pradesh mainly Kurnool, Chittoor and Anantapur district for tomato mosaic diseases incidence in tomato, where highest disease incidence of tomato mosaic symptoms was recorded in Anantapur district (6.30%), Kurnool district (5.04%) and lowest in Chittoor district (4.90%). Biological studies of ToMV-BG isolate was done by Electron microscopy and host range studies which resulted the presence of long, rigid rod shaped particles of 290 ± 10 nm in size indicating tobamovirus from leaf samples and host range studies resulted local lesions on N. glutinosa, N. benthamiana, N. tabacum cv. VT1158, navile, Tri spl, Samson and Datura stramonium in 2 to 3 DAI and systemic mosaic on Tobacco (Turkish xanthi) in 4 to 6 DAI. It gave necrotic lesions on brinjal, chilli, capsicum and potato at 4-5 DAI which further produced yellow lesions at 4-5 DAI on chenopodium and caused leaf yellowing, stem blackening followed by death at 9-10 DAI. Molecular characterization of ToMV has been done through PCR followed by its sequencing, The complete RNA genome consists of 6384 nucleotides and contains four open reading frames. The 5 proximal ORF encodes a 126.7 kDa product that terminates in an amber codon which may read through to produce a 184.4 kDa replication-associated protein (ORF2). ORF 3 codes for 28.8 kDa protein assumed to be involved in cell to cell movement of the virus. The last ORF4 encodes for 161 amino acids (17.4 kDa) of the coat protein (CP). Comparative sequence analysis of the ToMV-BG with ToMV isolates and other tobamoviruses has indicated that it had sequence nucleotide identity of 41.8 to 84.0% with other tobamoviruses, whereas 98.0 to 98.8% with different ToMV isolates. The phylogenetic analysis of ToMV isolates showed three main clades with a high bootstrap support, Clade III composed of ToMV isolate from Egypt (AHM) and the present ToMV isolate, Clade II composed of ToMV isolates from USA (Jasmine) and Zimbabwe and whereas Clade I was composed of isolates from India and the rest of the world. Out of 82 genotypes screened to identify resistant sources, two genotypes (Arka rakshak, IIHR 2858) found highly resistant reaction, two genotypes (V-102: L- 249; V-102: L-250) showed resistant reaction and the rest 78 genotypes showed susceptibility to ToMV. For identification and characterization of ToMV resistance in tomato, Resistance gene analogs (RGA) and molecular markers study revealed the amplification of RGA primers in resistant genotypes but not in susceptible genotypes. The phylogenetic analysis of amplified RGA fragments revealed Arka rakshak, IIHR 2858 have Tm2 and Tm22 tobamovirus resistant genes and V-102: L 249 have Tm2 resistant gene.ThesisItem Unknown STUDIES ON LEAF SPOT DISEASE IN ACID LIME (Citrus aurantifolia Swingle.) IN NELLORE DISTRICT OF ANDHRA PRADESH(COLLEGE OF HORTICULTURE ANANTHARAJUPETA-516 105, Y.S.R. DISTRICT, ANDHRA PRADESH, 2018-06-17) N. JHANSIRANI; Dr. B. Govinda RajuluThe present study entitled “Studies on leaf spot disease in acid lime (Citrus aurantifolia Swingle.) in Nellore district of Andhra Pradesh” was carried out in the Department of Horticultural Plant Pathology, College of Horticulture, Anantharajupeta,Y.S.R. Kadapa (Dist.), Andhra Pradesh during 2017-18. A roving survey was conducted in three mandals viz., Balayapalli, Dakkili and Venkatagiri of Nellore district to know the incidence of leaf spot diseases in acid lime orchards. Acid lime leaf spot caused by Colletotrichum gloeosporioides was more predominant with highest Per cent Disease Index (PDI) (26.08 %) was recorded from Dakkili mandal, whereas lowest PDI (17.3 %) was recorded from Venkatagiri mandal. Greasy spot caused by Mycosphaerella citri also observed on acid lime leaves. Maximum PDI (22.58 %) of greasy spot was recorded from Balayapalli mandal, whereas lowest PDI (14.44 %) was recorded from Venkatagiri mandal. Fifteen different locations were surveyed for leaf spot disease incidence, the pathogen was isolated from diseased leaves. Among fifteen isolates, majority of isolates were identified as Colletotrichum gloeosporioides and four isolates were identified as Colletotrichum acutatum, based on morphological and cultural characteristics. The pathogen of greasy spot was identified as Mycosphaerella citri which was further confirmed by NCFT, New Delhi. Colletotrichum gloeosporioides produced brown to blackish acervuli, brown to blackish setae with pointed end and single celled, hyaline conidia. Colletotrichum acutatum produced fusiform conidia with two oil globules, brown to blackish acervuli and no setae were observed. Different medium, such as potato dextrose agar, oat meal agar, corn meal agar and water agar were used for isolation. Among these, oat meal agar and potato dextrose agar medium were better for growth and sporulation of Colletotrichum gloeosporioides and Colletotrichum acutatum. From pathogenicity test by detached leaf technique, proved the Koch’s postulates, inoculation on mango seedling proved, Colletotrichum gloeosporioides has pathogenic ability to infect other hosts and has wide host range. Molecular characterization was conducted for major isolate i.e. Colletotrichum gloeosporioides. For identification of pathogen at molecular level, the genomic DNA was amplified with universal primes ITS 1 and ITS 4. From the results obtained, the genomic DNA amplified at a 550 bp. Sequences were analysed through NCBI-BLAST programme database search system. BLAST (mega blast) analysis for sequence similarity of ITS rDNA region confirmed the identity of the pathogen. Sequence was deposited in NCBI, the Accession number (MH368542) for that sequence. Phylogenetic tree was constructed by using neighbour-joining method and maximum likelihood for the ITS regions of Colletotrichum gloeosporioides isolated from the acid lime leaves with ITS sequences of Colletotrichum sp. isolated from different hosts. Based on phylogenetic analysis, the studied fungus 98 % similarity with Colletotrichum sp. XN-1-2 (Genbank Accession number- KR822134.1) isolated from leaves of Sophora japonica in China. And nearest homologue (97 %) was found to be with Colletotrichum gloeosporioides NW562a (Genbank Accession number EU5200761) isolated from poplar leaves in China. An in vitro experiment was conducted on Colletotrichum gloeosporioides with nine fungicides, viz.,Carbendazim 50% WP, Mancozeb 75% WP, Mancozeb 4%+ Metalxyl 64% WP, Chlorothalonil 75% WP, Propiconazole 25% EC, Copper oxychloride 50% WP, Hexaconazole 5% SC, Tebuconazole 50%+Trifloxystrobin 25% WP and Fosetyl- Al 80% WP for their inhibitory effect. Among them, Carbendazim 50 % WP, Mancozeb 75% WP, Mancozeb 4%+ Metalxyl 64% WP and Propiconazole 25% EC showed complete inhibition (100 %) of the pathogen at three different concentrations. Lowest inhibition was showed by Fosetyl-Al (8.8 %) at 0.05% concentration. Radial growth of the fungus on fungicide treated plate was recorded at every 24 h up to full growth obtained in the control plate. The mycelial growth was started from 48 h of inoculation and at every 24 h growth increased in the range of 5-10mm in all fungicide treated plates, except Carbendazim 50% WP, Mancozeb 75% WP, Mancozeb 4 %+ Metalxyl 64% WP and Propiconazole 25% EC. At 48 h radial growth started in Chlorothalonil (0.15 %, 0.2 % and 0.1 %) and Fosetyl- Al (0.05%, 0.1 % and 0.2 %) treated plates. In Copper oxychloride (0.1 %, 0.25 %, and 0.5 %) treated plates growth started at 72 h of inoculation. At 120 h, radial growth started in Hexaconazole 5% SC treated plates at 0.1 %, 0.075 % concentration. At 144 h growth started in Hexaconazole 5 % SC at 0.5 % concentration. In Tebuconazole 50 %+ Trifloxystrobin 25 % WP treated plates radial growth started in 0.03 % concentration at 168 h of inoculation.ThesisItem Unknown STUDIES ON RHIZOSPHERE MEDIATED MICROBIAL ANTAGONISTIC ACTIVITY AGAINST WILT PATHOGEN Fusarium oxysporum IN CHILLI (Capsicum annuum L.)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA-516 105, Y.S.R. DISTRICT, ANDHRA PRADESH, 2018-06-15) A. THOYAJAKSHI BAI; Dr. CH.RuthThe present investigation entitled “Studies on rhizosphere mediated microbial antagonistic activity against wilt pathogen Fusarium oxysporum in chilli (Capsicum annuum L.)” was carried out at College of Horticulture, Anantharajupeta during the year 2017-2018. A roving survey was conducted to record Fusarium wilt incidence under field conditions in Kurnool, Kadapa and Guntur districts of Andhra Pradesh (A.P.). The mean maximum disease incidence was observed in Kurnool district (21.34%) followed by Kadapa district (14.34%) and in Guntur district least mean disease incidence (3.46 %) was noticed. The wilt pathogens Fusarium oxysporum and Fusarium solani were isolated from collar region of infected chilli plant and their pathogenicity proved. Based on cultural and morphological characters, majority of isolates were identified as Fusarium oxysporum (NCFT, 081.17), (NCFT, 086.17) and few isolates were identified as Fusarium solani (NCFT, 082.17) and confirmed at National Centre for Fungal Taxonomy (NCFT), New Delhi. Rhizosphere antagonists were isolated from healthy rhizosphere soil samples collected from Kurnool, Kadapa and Guntur districts of A.P. A total of 20 rhizosphere microbes were isolated. Among these, 20 isolates (eight fungi, ten bacteria and two fluorescent Pseudomonads) were found to exhibit antagonism against chilli wilt pathogen. On further in vitro evaluation, nine isolates including four fungi, four bacteria and one Pseudomonas sp. were found to be more efficient antagonists. Siderophores, HCN and ammonia production tests were conducted for phenotypic identification of selected rhizosphere bacterial antagonists and tested for production of volatile and non-volatile inhibitory metabolites of the selected rhizosphere fungal isolates. Among them fluorescent pseudomonads RFP 1 was positive to siderophore, HCN and ammonia production. All the tested fungal antagonists were positive to both volatile and non-volatile metabolites production. The molecular identification of promising rhizosphere fungal antagonists carried out by using universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS 4 (TCCTCCGCTTATTGATATGC). Fungal antagonist RFA 1 was identified as Faculty : Horticulture Major Advisor : Dr. Ch. Ruth University : Dr. Y. S. R. Horticultural University Year of submission : 2018 Aspergillus versicolor and RFA 4 was identified as Trichoderma asperellum which have amplified at 500-600 base pairs. The sequenced nucleotides were compared against Gen Bank database using the NCBI BLAST algorithm, the BLAST results showed 98% similarity of the isolate RFA 4 with Trichoderma asperellum whereas 97% similarity of the isolate RFA 1 with Aspergillus versicolor. Based on nucleotides homology and phylogenetic analysis the microbe RFA 4 was detected as Trichoderma asperellum isolate CTCCSJ-AMH50465 (Gen Bank Accession Number: KU896361.1) and the nearest homology was found to be Trichoderma harzianum isolate Th-3 (Gen Bank Accession Number: MH127468.1). The microbe RFA 1 was detected as Aspergillus sp. N22 (Gen Bank Accession Number: GQ169462.1) and the nearest homology was found to be Aspergillus versicolor voucher BJ1-3 (Gen Bank Accession Number: KX527869.1), further the sequenced isolates were deposited in the NCBI data base with accession number MH- 392619 for RFA 1 and MH- 371476 for RFA 4, respectively. Molecular identification of promising rhizosphere bacteria was conducted by the use of primers, 27F(AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTTS) the bacteria were identified as Bacillus subtilis and Bacillus pumilus which have amplified at 1000-1160 base pairs. They were sequenced and the sequenced nucleotides were compared against Gen Bank database using the NCBI BLAST algorithm, the BLAST results shown the 80% similarity of the isolate RBA 3 with Bacillus pumilus and 90% of the similarity of the isolate (RBA 1) with Bacillus subtilis. Further phylogenetic tree was plotted using neighbour joining method to find homology with other relevant species. Based on nucleotides homology and phylogenetic analysis the microbe (RBA 3) was detected to be Bacillus pumilus strain BAB-244 (Gen Bank Accession number: HQ699945.1) and the nearest homology was found to be Bacterium M2(2015) strain M2 (Gen Bank Accession Number: KP721632.1) whereas the microbe RBA 1 was detected to be Bacillus subtilis strain RMLP2 (Gen Bank Accession number: KY794215.1) nearest homolog was found to be Bacillus sp. NXUSASBL004 (Gen Bank Accession Number: KP165008.1). The compatibility of the selected rhizosphere fungal antagonist RFA 2 to eight fungicides were assessed. Copper oxy chloride, Carbendazim, Hexaconazole and Propiconazole+Difenconazole were highly incompatible and showed cent percent inhibition on the growth of the antagonist at all tested concentrations from 24 hrs. to 168 hrs. of inoculation. Whereas copper oxy chloride (0.2% and 0.3%) and Metalaxyl + Mancozeb (0.1% and 0.2%) have shown high compatibility with RFA 2 after 120 hrs. and 144 hrs. of inoculation followed by Tebuconazole and Difenconazole which are moderately compatible with RFA 2 even at lower concentrations at 168 hrs. after inoculation. The compatibility of fungicides towards the selected rhizosphere fluorescent pseudomonad RFP 1 was assessed. The fungicides Tebuconazole, Difenconazole, Thio phanate methyl and Coper oxy chloride were highly incompatible with Pseudomonas (RFP1). Whereas Carbendazim, Metalaxyl+ Mancozeb, Thio phanate methyl and Difenconazole at their lower concentrations were compatible with RFP1.ThesisItem Open Access IN VITRO AND IN VIVO BIOLOGICAL AND FUNGICIDAL EVALUATION AND SCREENING OF GERMPLASM TO FUSARIUM ROOT ROT PATHOGEN FOR ITS RESISTANCE IN CORIANDER (Coriandrum sativum L.)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA-516 105, Y.S.R. DISTRICT, ANDHRA PRADESH Dr. Y.S.R. HORTICULTURAL UNIVERSITY, 2017-07-03) M. S. V. SATYANARAYANA; Dr. K. GOPALThe present study entitled “In vitro and In vivo biological and fungicidal evaluation and screening of germplasm to Fusarium root rot pathogen for its resistance in coriander (Coriandrum sativum L.)” was conducted at Horticultural Plant Pathology Laboratory, College of Horticulture (COH), Anantharajupeta, Andhra Pradesh during 2016-17. A survey was conducted in Kadapa, Kurnool, Guntur and Prakasam districts for soil borne diseases incidence in coriander where highest disease incidence of Fusarium root rot was observed in Kurnool district (38.71%), Wilt (10.35%). Coriander is severely affected with Fusarium root rot caused by Fusarium solani leading to the death of plants. The pathogen was isolated from infected plants on the basis of morphological and cultural characters, identified as Fusarium solani. An experiment was laid out in augmented randomized block design with a concept to screen resistant germplasm for Fusarium root rot with 120 germplasm along with three checks Sudha, Sadhana and APHU Dhania-1. Observations were recorded on initial and final population, disease incidence, AUDPC, plant growth and agronomical characters in coriander. Among different coriander genotypes studied in the experiment, highest initial population was observed in accession LCC-31 (26) whereas least disease incidence (2.73%) and AUDPC (40.91) were recorded in LCC-22. Highest plant height (38cm) and more number of branches/plant were recorded in LCC-174 and LCC-12 (8.67) respectively. More number of umbels/plant in LCC-268(28.24); highest number of umbellets/plant in LCC-78 (140); highest number of umbels/compound umbel in LCC-31 (7); highest number of umbellets/umbel in LCC-259 (23); highest number of seeds/plant (g)in LCC-109 (1.64) and highest crop duration of 106 days in LCC-149 were recorded. Further in vitro experiment was conducted on F. solani with four bioagents and six chemical fungicides for their inhibitory effect. Among them Trichoderma harzianum with 69.05% and Carbendazim + Mancozeb with 100% inhibition of Fusarium solani was found best in dual culture and poisoned food techniques respectively.. An in vivo experiment was conducted with six treatments including IDM treatments along with control (T7). Among the treatments tested Neem cake +T. harzianum (T4) was found significantly superior with regard to disease incidence (9.8%, AUDPC value 610) followed by followed by Neem cake + Carbendazim + Mancozeb (Saaf at 0.25 %) (15.6%, AUDPC of 1040), plant height (37.7cm), number of branches/plant (4.7), umbels/plant (6.3), umbellets/umbel (5.0), root length (16.5 cm), seeds/umbel (6.7) and followed by yield/plant (1.8 g).ThesisItem Open Access STUDIES ON ENDOPHYTIC MICROBIAL DIVERSITY AND ANTAGONISTIC EFFECT ON RHIZOME ROT PATHOGENS IN TURMERIC (Curcuma longa L.)(COLLEGE OF HORTICULTURE ANANTHARAJUPETA-516 105, Y.S.R. DISTRICT, ANDHRA PRADESH Dr. Y.S.R. HORTICULTURAL UNIVERSITY, 2017-07-18) M. LAKSHMI NAGA NANDINI; Dr. CH. RUTHThe present investigation entitled “Studies on Endophytic microbial diversity and antagonistic effect on rhizome rot pathogens in turmeric (Curcuma longa L.)” was carried out at College of Horticulture, Anantharajupeta during the year, 2016-2017. A roving survey was conducted to estimate rhizome rot incidence under field conditions in five districts of Andhra Pradesh. The mean maximum disease incidence was observed in Guntur district (16.12%) followed by West Godavari district (12.68%) and in Visakhapatnam district least mean disease incidence (2.18%) was noticed. The organisms causing rhizome rot disease of turmeric were isolated from infected rhizomes and their pathogenicity proved. Based on cultural and morphological characters, pathogens were identified as Pythium ultimum and Fusarium solani. Endophytes were isolated from healthy rhizome samples collected from different locations of Andhra Pradesh. The population of endophytic microflora varied among the samples collected from different locations. Bacteria (10.40 x 106 cfu g-2) and fluorescent Pseudomonads (13.40 x 106 cfu g-2) population were more in number than fungi (5.42 x 106 cfu g-2). A total of 58 endophytes were isolated. Among these, 24 isolates (Fifteen fungi, five bacteria and four fluorescent Pseudomonads) were found to exert antagonism towards pathogens of turmeric. On further in vitro evaluation, seven isolates including four fungi and three bacteria of endophytic origin were selected as efficient antagonists. For studying the mechanism of antagonism of the selected isolates, they were subjected to various tests like production of ammonia, siderophore, HCN,IAA, volatile and non volatile metabolites. The bacterial isolates Tc ed b 2 and Tc ed b 3 produced more ammonia. All isolates were negative to HCN and siderophore production while others produced varying levels of IAA. The selected fungal isolates produced non-volatile metabolites inhibitory to the pathogens tested. Further, the compatibility of selected antagonists with seven fungicides and five insecticides were studied. The fungal antagonist was incompatible with fungicides like Bordeaux mixture, Carbendazim (12%) + Mancozeb (64%) (Saaf) and insecticide Phosphamidon (40%) (Demecron), showed cent percent inhibition on the growth of the antagonist. Others showed varying levels of inhibition. The bacterial antagonist was compatible with mancozeb (4%) + metalaxyl-M (64%) (Ridomil Gold MZ), carbendazim (12%) + mancozeb (64%) (Saaf), cyamoxanil (8%) + mancozeb (64%) (Curzate M8), mancozeb (Indofil M-45), lower concentration of fenamidone (10%) + mancozeb (50%) (Sectin) while it was incompatible with Bordeaux mixture, copper oxychloride (50%) (Blitox). All concentrations of thiomethoxam (25%) (Cruiser) and phosphamidon (40%) (Demecron) were compatible with antagonist while the reverse was with that of chlorpyriphos (20%) (Dursban), dimethoate (30%) (Rogar) and malathion (50%). The fungal antagonists were identified as Aspergillus oryzae (Tc ed f 1), Penicilium chrysogenum (Tc ed f 2), Trichoderma viride (Tc ed f 3) and Trichoderma harzianum (Tc ed f 4). Three of the bacterial isolates (Tc ed b 1 and Tc ed b 3) were tentatively identified as Pseudomonas sp. while the other one (Tc ed b 2) as Bacillus sp. Under field conditions, out of 120 turmeric lines screened, thirty lines (14 short duration, 5 medium duration, 11 long duration) were found resistant to rhizome rot disease. IC-319341, Tenali Kasturi, VK-23, GS, IC-420606, IC-033007, IC-211641, PTS-8, Vikici, Dhindigam, ACC-48, Sonia, NB-60, Kasturi in short duration group, Prathibha, Thodupuztha, KTS-9, Prasangali, ACC-79 in medium duration group and NH-1, Ranga, Salem, Salem-2, Wagon, PTS-12, CL-8, CL-9, CL-10, CL-3, CL-4 in long duration group were resistant to rhizome rot showed 0.0% infection. In case of rhizome yield, medium duration turmeric line RH-50 (1.69 kg/plant) was significantly superior over all other genotypes evaluated. Under pot culture conditions, out of 30 turmeric lines screened, Salem and Prathibha were found resistant to rhizome rot with 0.0% infection.
