Theses

Browse

Search Results

Now showing 1 - 9 of 79

Open Access
Management of bitter gourd mosaic by enhancing host resistance
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2015) Ashwini, K N; KAU; Vimi, Louis
Bitter gourd (Momordica charantia L.) is one of the important vegetable crops that occupy a pivotal position among fruit vegetables, particularly in south India. The fruits of this crop which have high commercial value and are being used for culinary preparations and various medicinal preparations. In spite of the economic importance of this vegetable, the research work carried out on protection of crop from viral disease is quite scanty. In many case, cent per cent mosaic incidence was recorded in the crop resulting in substantial economic loss. So the present study was focused on screening of bitter gourd accessions and management of bitter gourd mosaic by enhancing host resistance using defense inducers. The three different viruses causing mosaic in bitter gourd are cucumber mosaic virus (CMV), potyvirus and bitter gourd distortion mosaic virus (BDMV). As these viruses causes mixed infection in field, the separation of individual viruses was carried out using systemic indicator host plants. For separation of CMV and potyvirus, systemic indicator host plants used were cosmos and papaya respectively. BDMV was separated by white fly transmission. The pure cultures of viruses were maintained on the susceptible bitter gourd variety Preethi. The symptoms developed by different viruses were recorded under natural and artificial conditions were recorded CMV produced mosaic specks, yellow-green mosaic patches, leathery leaves and downward rolling of leaf margin. Symptoms of potyvirus infection were vein clearing, puckering, malformed leaf with reduced leaf size and rugosity. BDMV infection produced mosaic, puckering, leaf distortion, hairy growth on leaves and vines with reduction in leaf size and internodal length. For the screening of bitter gourd accessions against CMV and potyvirus, potassium phosphate buffer pH 7.0 was found to be the most suitable buffer. Among 22 accessions screened, three accessions viz., TCR 285, TCR 39 and TCR 53 were highly resistant to CMV; one accession Biliagala was highly resistant to potyvirus and 11 accessions viz.,TCR 285, TCR 39, TCR 493 ,TCR 416, TCR 492, TCR 494,TCR 380, TCR 202 and TCR 149, Green long and Biliagala were highly resistant to BDMV. The field experiment was undertaken with the objective of management of bitter gourd mosaic by using defense inducers. The three different defense inducers viz., salicylic acid 25 ppm, barium chloride 0.1% and Pseudomonas fluorescens 2 % were evaluated on the moderately resistant cultivar white long and susceptible variety Preethi. The mosaic symptom was recorded after 51 days of sowing in salicylic acid treated plants and after 40 days of sowing in control. A time gap of 5-10 days after spray of defense inducer was required for development of resistance in plants. The lowest disease severity was observed in cultivar White long treated with salicylic acid. The highest yield was recorded in Preethi treated with Pseudomonas fluorescens.
Open Access
Physiological and cultural studies on blue oyster mushroom (Hypsizygus ulmarius (Bull.:Fr.) Readhead)
(Department of Plant Pathology, College of Agriculture, Vellayani, 2016) Sumi, I; KAU; Geetha, D
The present study entitled “Physiological and cultural studies on blue oyster mushroom (Hypsizygus ulmarius (Bull.:Fr.) Redhead)” was carried out in the mushroom unit, Instructional Farm, College of Agriculture, Vellayani during 2014-2016, with the objective to standardize the technology for cultivation of Hypsizygus ulmarius and to study its morphological and physiological aspects. The initial culture of H. ulmarius was isolated from the mushroom beds maintained in the mushroom unit of instructional farm through tissue culture method and purified by hyphal tip method. Morphological studies of H. ulmarius showed that the sporocarps were medium to large in size having a dark blue colour in the pinhead stage which became creamy white on maturity with an irregularly shaped, convex pileus with gills attached to the stem, but not decurrent and cylindrical, smooth and eccentric stipe. Microscopic studies revealed septate hypahe with clamp connection, oval shaped, hyaline basidiospores and the spore print was white. Studies on developmental morphology showed that H. ulmarius took an average of five days from the day of pinhead formation to complete maturity. The maximum mycelial growth was recorded on potato dextrose agar. A temperature of 25 0C, pH of 8 and dark conditions are found favourable for maximum mycelial growth. Evaluation of different substrates for spawn production revealed that paddy grains was the best medium in which spawn run was completed in fifteen days with thick fluffy growth and recorded less contaminants followed by wheat and sorghum. Evaluation of different substrates for mushroom production revealed that paddy straw was the best material for the cultivation of blue oyster with a total yield of 985 g kg-1 from three harvests followed by rubber sawdust (905 g kg-1). The minimum time for mushroom production was recorded for sugarcane bagasse and the maximum time for rubber sawdust. The average weight of sporocarp was maximum in mushrooms harvested from rubber sawdust and the maximum number of sporocarps was recorded in paddystraw. Beds prepared from sugarcane bagasse were heavily contaminated with Trichoderma sp. When compared with Pleurotus florida, H. ulmarius took more time (18 days) for complete spawn run in paddy grains and the yield was higher on paddy straw (1.096 kg kg-1) than P. florida (976 g kg-1). Infestation of pests viz., phorid flies (Megaselia sp.) and staphylinid beetles were prevalent during spawn run as well as sporocarp formation. The competitor moulds recorded were Trichoderma sp., Aspergillus sp. and Coprinus sp. Analysis for the proximate constituents in H. ulmarius revealed that it contains appreciable amount of carbohydrate (29 %), protein (32 %) and fibre (17.69 %). Sensory evaluation was done on steam cooked mushrooms for attributes like appearance, colour, texture, flavor and taste using five point score card and an overall acceptability score of 3.6 was obtained for H. ulmarius compared to P. florida (3.0). In the preference study conducted for both the mushrooms using Hedonic rating scale, 30 per cent of evaluators extremely liked H. ulmarius than P. florida (10 %). The study on the keeping quality of mushrooms in normal atmospheric condition indicated a shelf life of eight hours for H. ulmarius compared to six hours for P. florida. The study also showed that blue oyster mushrooms stored under refrigeration (4 0C) in perforated polythene covers had better shelf life (5 days) compared to P. florida (3 days). The present study indicated that blue oyster mushroom can be cultivated successfully in tropical areas on locally available materials like paddy straw and rubber saw dust under favourable climatic conditions viz., 26-28 0C temperature, more than 90 per cent relative humidity and good aeration. The variety is superior to the presently growing oyster mushroom (P. florida) in terms of yield, presence of appreciable amount of proximate constituents and keeping quality.
Open Access
Integrated management of rhizoctonia leaf blight of amaranthus (Amaranthus tricolor L.)
(Department of Plant Pathology, College of Agriculture, Vellayani, 2016) Gireesh; KAU; Radhakrishnan, N V
The study entitled “Integrated management of Rhizoctonia leaf blight of Amaranthus (Amaranthus tricolor L.)” was conducted at the College of Agriculture, Vellayani and Coconut Research Station, Balaramapuram during 2014-2016 with the objective to investigate the effect of soil solarization, biocontrol agents, chemical activator, indigenous formulations and new generation fungicides on growth, yield and severity of foliar blight of amaranthus. Samples of the infected leaves showing Rhizoctonia leaf blight in amaranthus were collected from Vellayani, Kalliyoor, Venganoor and Kakkamoola locations. Among the four isolates of the pathogen, the Vellayani isolate gave significantly superior growth rate with minimum of six days for sclerotial formation. Koch‟s postulates were proved for the pathogenicity of different isolates of Rhizoctonia solani. All the four isolates have taken three days for the first symptom development but the progression of lesion size of Vellayani isolate was maximum compared to all other isolates, hence the Vellayani isolate was selected as the most virulent isolate for use in further in vitro studies. Evaluation of biocontrol agents for in vitro suppression of R. solani showed that Trichoderma harzianum completely overgrown the pathogen with maximum inhibition of 49.56 % compared to Pseudomonas fluorescens (28.30 %). Under in vitro evaluation of chemical activator, different concentrations of Acibenzolar-S- Methyl (ASM) against pathogen, 100 ppm concentration recorded the maximum mycelial inhibition of 75.67 % and 5 ppm concentration recorded the minimum mycelial inhibition of 27.70 %. Among indigenous organic formulations, turmeric powder and baking soda combination inhibited the maximum growth of the pathogen by 64.40 %. In the in vitro studies with new generation fungicides,mancozeb in cow dung supernatant (0.4 %) and tebuconazole (0.1 %) recorded the 100 % mycelial inhibition of the pathogen. Field studies on disease suppression and plant growth promotion was carried out as two experiments, one in soil solarized plots and the other in non solarized plots. Soil solarization along with soil application of ASM (75 ppm) and foliar application of ASM (100 ppm) recorded the lowest disease incidence of 30.41 % and 30.42 % respectively, which was superior when compared with foliar application of ASM (100 ppm) and soil application of ASM (75 ppm) with the disease incidence of 37.06 % and 38.84 %. Soil solarization + foliar spray of tebuconazole (0.1 %) recorded the minimum disease index of 37.85 % which was superior compared to foliar spray of tebuconazole (0.1 %) with the disease index of 39.28 %. Among the biocontrol agents soil solarization + foliar spray of Pseudomonas fluorescens (2 %) gave minimum disease index of 45.22 % which was greater compared to foliar spray of P. fluorescens (2 %) with the disease index of 51.66 %. In case of indigenous organic formulations, soil solarization + foliar spray of fish amino acid (5 %) given the maximum control of the disease with the disease index of 49.51 % which was superior to foliar spray of fish amino acid (5 %) with disease index of 63.59 %. The number of days taken for flowering in soil solarized plots ranged from 28.67 to 35 days where as the number of days taken for the flowering of amaranthus in non solarized plots was ranged from 27.27 to 31.67 days. At the time of harvest, soil solarization + mancozeb in cow dung supernatant (0.4 %) recorded maximum plant height of 127.07 cm which was higher compared to foliar spray of azoxystrobin (0.15 %) with plant height of 117.60 cm. Maximum of 78.00 number of leaves were recorded by soil solarization + foliar spray of azoxystrobin (0.15 %) which was greater compared to foliar spray of azoxystrobin (0.15 %) with 67.67 number of leaves.Soil solarization + foliar spray of azoxystrobin (0.15 %) gave the highest yield in terms of fresh weight by 26975.00 kg/ha and dry weight of 4233.33 kg/ha which was superior when compared with foliar spray of tebuconazole (0.1 %) with the fresh weight of 23375.00 kg/ha and dry weight of 3362.50 kg/ha. It is concluded that soil solarization for 31 days with the foliar application of tebuconazole (0.1%) can effectively control the Rhizoctonia leaf blight disease severity with plant growth and yield promotion under field conditions.
Open Access
Molecular detection and characterization of phytoplasma infecting brinjal (solanum melongena L.)
(Department of Plant Pathology, College of Agriculture, Vellayani, 2015) Saranya, S S; KAU; Umamaheswaran, K
The study entitled “Molecular detection and characterization of phytoplasma infecting Brinjal (Solanum melongena L.) was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani, with the objectives to study the symptom development, transmission, molecular detection and characterization of phytoplasma infecting brinjal and its relationship with phytoplasma diseases of other crop plants. Brinjal little leaf (BLL), collected from the Crop museum, College of Agriculture, Vellayani and catharanthus little leaf (CLL) obtained from Coimbatore were maintained for further studies. Symptomatology revealed the characteristic little, narrow, soft, glabrous and smooth leaves produced as clusters along with yellowing, proliferation of axillary shoots, shortened internodes, stunted bushy or rosette appearance and phyllody, the conversion of floral parts into leaf like structures. The graft transmission was found to be 100% successful while the percentage transmission by dodder was only 10% in brinjal and 20% in catharanthus. Phytoplasma was maintained in vivo in plants by grafting and in vitro by culturing the infected explants on MS media supplemented with 0.2 mg l-1 BAP, 0.6 mg l-1 NAA and 0.4 mg l-1 IAA. Biochemical analysis of healthy and diseased plants revealed that the contents of protein, phenol and chlorophyll were reduced in the inoculated plants as a result of phytoplasma infection. Carbohydrate content in brinjal increased immediately after inoculation and then decreased. The activity of peroxidase (PO) was enhanced in the inoculated plants while that of polyphenol oxidase (PPO) was reduced. The activity of phenyl alanineammonialyase (PAL) was reduced immediately after the inoculation, but enhanced at 30 and 60 days after inoculation (DAI). 91 92 The electrophoretic analysis of proteins using SDS-PAGE revealed the presence of two extra protein bands in the infected samples with molecular weights of 29 kDa (Kilo Dalton) and 43 kDa. The isozyme pattern analysis of peroxidase using native PAGE revealed two isoperoxidase bands in the inoculated plants with Relative mobility (Rm) values, 0.17 and 0.47, but a single band in healthy plants with Rm value of 0.17. Molecular detection was done using nested PCR. PCR products of ~1.8 kb (Kilo base) were obtained in direct PCR with phytoplasma universal primer pair P1/P7 and the nested PCR with P1/P7 followed by R16F2n/R16R2 amplified the fragment of size 1.2 kb. The presence of phytoplasma in tissue culture plants was also confirmed using nested PCR. Comparative nucleotide sequence analysis of brinjal and catharanthus isolates with the existing data base from NCBI revealed a 100% homology with brinjal little leaf phytoplasma isolates from Haryana and IARI and 99% homology with potato witches’ broom, potato purple top, tomato big bud phytoplasma etc. The 16S rDNA sequences of BLL and CLL phytoplasma shared 99.7% similarity with that of ‘Candidatus Phytoplasma trifolii (Ca. Phytoplasma trifolii)’. Thus the two phytoplasma isolates were identified as the related strains of ‘Ca. Phytoplasma trifolii’.
Open Access
Standardization of technique cultivation of Tricholoma giganteum Massee in Kerala
(Department of Plant Pathology, College of Agriculture,Vellayani, 2013) Prathibaha, P R; Lulu Das
The present investigation on “Standardization of techniques for cultivation of Tricholoma giganteum (Massee) in Kerala” was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani, during 2012-2013. The aim of the study was to explore the possibility of cultivation of Tricholoma giganteum (Massee) on readily available cheap substrates and to develop a package for commercial cultivation in Kerala. Mushrooms were collected from different parts of Trivandrum districts before and after the South West and North East monsoons. Preliminary trials laid out showed that isolate 1 was the best out of 4 isolates which was sent to DMR. This isolate with accession number DMRO- 462 was used for further studies. Tricholoma has a convex pileus, off white to creamy white in colour, fleshy in texture and with a stout hairy stipe. Cultural studies conducted showed that the isolate attained full growth in petridish in 14 days on oat meal agar and least growth was found in carrot agar medium. Out of six carbon sources dextrose was found to be best for the radial growth of Tricholoma, least growth was found in galactose. Among the seven nitrogen sources used to study the radial growth of Tricholoma in petridish beef extract was found to best and least in ammonium nitrate. Temperature of 35 ⁰C, fluorescent light conditions and pH8 were found to be the best for the growth of Tricholoma giganteum. Evaluation of six different spawn substrates showed that paddy grains was best spawn substrate since complete spawn run was attained in two weeks. Regarding yield studies beds laid out with wheat grain spawn gave highest yield of 833.33 g / bed. Saw dust took maximum time for spawn run and lowest yield was also recorded in it. Six different locally available cheap substrates viz., paddy straw, sugarcane bagasse, saw dust, coir pith compost, spent mushroom substrates and coir pith + paddy straw were used for the cultivation of Tricholoma giganteum. Highest yield (694.50 g) was found to be in beds prepared from paddy straw and lowest yield (199.50 g) was observed in beds laid out with coir pith + paddy straw as substrate. Out of the casing materials tried vermi compost was found to be the best. Lowest yield was found be in beds cased with red soil + sand. Analysis of nutrient composition of Tricholoma giganteum indicated that, the moisture content, protein, fat, carbohydrate, ash and fibre content was found to 87.46 %, 23.20 %, 2.60 %, 10.10 %, 11.46 % and 19.01 % respectively. The shelf life of fresh mushroom was high (7 days) when stored in polypropylene cover without perforation in refrigerated condition. For mushroom dried in hot air oven the shelf life was found to be 60 days. Pests like sciarid flies and staphylinid beetle were prevalent after the second harvest only. Coprinus, cob web (Cladobotryum dendroides) and Trichoderma causing decay of the fruiting body was observed in Tricholoma giganteum beds when temperature and relative humidity was high. Results of organoleptic studies revealed that Tricholoma has high cooking quality and overall consumer acceptability was good. Cutlets were found to be the best when consumed by the panel of judges followed by payasam. The overall acceptability of soup made out of dried mushroom powder was comparatively poor. Based on the results obtained during the investigation it can be concluded that Tricholoma is a new summer edible mushroom most suited for the Kerala conditions. The technology of cultivation of Tricholoma on paddy straw substrate using wheat or paddy spawn and vermi compost as casing material can be recommended as a suitable domestication package which will be transferred to the farmers along with the release of this mushroom variety.
Open Access
Characterization and management of ganoderma lucidum inciting basal stem rot of coconut
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2012) Yunus, C; KAU; Beena, S
The present study on “ Characterization and management of Ganoderma lucidum inciting basal stem rot of coconut ” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2010-2012 with an aim to isolate the pathogen associated with the disease and to study the cultural, morphological and pathogenic characters of different isolates of the pathogen, symptomatology of the disease, host range and effective management of the pathogen using bio-control agents, phytoextracts and selected fungicides. Purposive sampling surveys were conducted and the occurrence of basal stem rot disease of coconut was observed through out Kerala. The isolation of pathogen from basidiocarps yielded eight isolates of Ganoderma sp. which produced fruiting body in saw dust- rice bran substrate. The pathogenicity of these isolates was tested and observed yellowing, drying and drooping of leaves of coconut seedlings inoculated with all isolates except the isolate GT- from Trivandrum. Basidiocarp formation was noticed only in one seedling inoculated with the isolate GV from Vellayani and reisolation of pathogen was done from this basidiocarp. Symptomatology of the disease under natural and artificial conditions was studied. Under field condition the typical symptom of BSR disease viz., yellowing and drooping of leaves, stem bleeding and basidiocarp formaton were observed in all surveyed areas but all the typical symptoms of disease were not observed under artificial condition. The cultural characters of all the isolates of pathogen were studied on four media viz., Potato dextrose agar, Czapek’s (DOX) agar, Richard’s agar and Soil extract agar media. All isolates produced white mycelial growth on all media but variations in texture, mycelial type, and colour change of mycelium, exudates production and formation of aberrant fruiting body were observed. PDA was found to be the best medium for the growth of pathogen in which all isolates recorded highest growth rate. The pathogen preferred a temperature range of 30-350C and neutral to acid pH of 5-7 for the growth. Slight variation in growth rate was observed under light and darkness. Basidiocarps showed variations in the morphological characters and were stipitate in all isolates except GC from Chirakkacode and GVe from Vettikkal, semicircular to conical shaped, yellowish red to reddish brown with smooth to waved margin, creamy white to brown pore surface, 4.4 – 12.0 x 2.6- 17.0 cm size, 1-10 mm pore length, 139- 254 x 122 – 190 μm pore diameter and 2-10 mm flesh thickness. Basidiospores were brown, ovate to ellipsoidal, truncated apex, double walled with inter wall pillars separating two walls. The size of these basidiospores showed variation in the range of 4.8-13 x 4.5-7.0μm with a spore index of 1.15-1.7. It was trimitic, with generative hyphae hyaline, thin walled, branched, septate and clamped. Reddish brown pigmented skeletal hyphae and colourless binding hyphae were noticed. Based on these observations the eight isolates of the pathogen were identified as Ganoderma lucidum (Leys) Karst. Regarding the in vitro management of the pathogen, two isolates of T. virens and one isolate of T. viride were isolated from rhizophere soil and were proved equally effective with the reference culture, T. viride and T. harzianum in inhibiting the growth of pathogen. Mycoparasitism and production of non volatile metabolites were found to be the mechanisms exhibited by the selected Trichoderma spp. The bacterial antagonists obtained from rhizosphere soil and the reference culture P. fluorescens recorded less than 50 percent inhibition on the growth except in cases of few isolates of the pathogen. It was observed that the selected bacterial antagonists were not much effective in inhibiting the pathogen compared to fungal antagonists. Among the phytoextracts, Azadirachta indica at 20 per cent concentration was found the most effective and recorded more than 50 percent inhibition on the growth of pathogen over control. It was followed by Musa sp. at 10 per cent concentration. The in vitro evaluation of fungicides showed that flusilazole, hexaconazole and iprobenphos at 0.2 per cent concentration were the most effective and recorded cent per cent inhibition on the growth of all isolates of pathogen. The study on the host range of G. lucidium revealed that the seedlings of arecanut, breadfruit, acacia and jack fruit showed yellowing and drooping of leaves and finally wilting of all the seedlings were observed
Open Access
Immunological and molecular detection of banana viruses and production of disease free planting materials
(Department of Plant Pathology, College of Agriculture, Vellayani, 2014) Aliya, Ferzana; KAU; Umamahesaran, K
The study entitled "Immunological and molecular detection of banana viruses and production of disease free planting materials" was conducted in College of . Agriculture, Vellayani, and Thiruvananthapuram during !he period of2011-2014. Symptomatological studies showed that the characteristics symptoms caused by BBTV were small, brittle leaves with thickened veins which remained bunched at the top of the pseudostem. Plants with early infection did not produce fruits, where plants with later infection produce bunch with reduced size, weight and mishapen fingers. The characteristic symptoms caused by BBrMV were reddish spindle shaped lesion in the pseudostem, flag leaf sheath, leaf petiole, and bract. Leaves of infected plants showed characteristic chlorotic spindle shaped lesion on the leaf lamina. The characteristic symptoms of BSV were chlorotic streaks in the leaf lamina. Later the chlorotic streaks became necrotic. The characteristic symptom of CMV was mosaic pattern in the leaf lamina. The pathophysiological studies conducted in cultivar Nendran revealed that there was significant difference in carbohydrate, chlorophyll, protein and phenol content in infected plant when compared to healthy ones .. The activity of defence related enzymes like peroxidase, polyphenol oxidase and phenylalanine ammonialyase were found to be more in infected plants. Electrophoretic analysis of protein in virus infected samples through SDS-PAGE revealed the presence of an additional protein in the protein profile. The protein profile of BBTV infected sample showed one extra band with molecular weight of 20 kDa, BBrMV infected sample showed three additional protein band with molecular weight of 38 kDa, 29 kDa and 22 kDa, BSV infected sample showed three additional proteins with molecular weight of 25 kDa, 19 kDa, and 12 kDa, CMV infected sample showed one extra band with molecular weight of 25 kDa. Electrophoretic analysis of isozyme though native gel revealed the increased action of peroxidase enzyme in infected sample. Detection of VIruS infecting banana was carried out using varIOUS immunological techniques such as DAC-ELISA and DIBA using polyclonal antiserum (Agdia) and monoclonal antiserum. Both the techniques were found to be efficient in detecting virus infecting banana. Molecular diagnosis of the BBTV was carried out using CP gene and replicase gene specific primers. PCR product with amplicon size of about 530 bp was observed for coat protein gene specific primer where 237 bp was observed for replicase gene specific primer. Molecular diagnosis of BSV was carried out using two CP gene specific primers resulted in PCR product with amplicon size of 664 bp and 730 bp. Molecular diagnosis of CMV was canied out using CP gene specific primer resulted in PCR product with an amplicon size of 687 bp. CP gene specific primer for BBrMV did not give positive result. Cluster dendrogram analysis revealed that the BBTV isolate was mostly related to BBTV coat protein gene of Burundi isolate, BSV isolate was mostly related to banana streak virus isolate Trichi, CMV isolate was mostly related to cucumber mosaic virus isolate Trichi coat protein gene. The meristematic region of the virus infected banana suckers were excised and inoculated to MS media with BAP and NAA. The regeneration of plants from meristematic region was difficult because of high phenol production and contamination by endogenous bacteria. Meristem culture eliminated BBTV, CMV and BBrMV but not the BSV. Based on the research result, the banana VIruses can be detected usmg immunological and molecular technique and the meristem culture can eliminate all the banana viruses except BSV.
Open Access
Symptomatology and molecular diagnosis of banana streak virus disease.
(Department of Plant Pathology ,College of Horticulture, Vellanikkara, 2011) Divya, C R; KAU; Anitha Cherian, K
The banana (Musa spp.) is a crop of global importance in terms of income security to million of small farmers throughout the developing countries. It is the world's fourth most important commodity after rice, wheat and corn and is produced in tropical and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria and viruses. Among the viral diseases, Banana streak is now emerging as a major disease affecting banana production world wide. This disease assumes significance as it affects plant growth, fruit yield and quality. It is also causing problems to germplasm exchange and in the certification of in vitro plantlets for international trade. The present project was undertaken to study the symptomatology of Banana streak disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of Banana streak virus, to standardize molecular indexing of planting materials of banana and to identify the source of resistance in the field gene bank. The symptoms of the disease appeared on different parts of the plant such as leaf lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later turned necrotic, blackened and running perpendicular to the leaf axis extending from midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina especially on older leaves. Dark brown coloured linear lesions appeared on other parts like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and death of cigar leaf was noticed. The plants showing such symptoms did not flower and resulted in 100 percent yield loss. The impact of the disease on biometric and yield characters was studied and observed that the disease affected the growth and yield of banana. A significant correlation was observed between the expression of symptoms with rainfall and temperature. The expression of the symptoms was more in cooler months and less in summer. The field gene bank comprising 290 accessions maintained at BRS, Kannara was screened to assess the reaction of these accessions to the disease. The disease incidence was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB), Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3 (AAAB). The percent disease incidence ranged from13.25 to 32.16 . The transmission studies proved that BSV was not transmitted mechanically or through infected soil. The insect vectors of BSV were proved to be two species of mealy bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The studies on virus vector relationship of these mealy bugs showed that the maximum acquisition feeding period, pre-acquisition fasting period, inoculation access period required for successful transmission were three days, one hours and seven hours respectively. The nymphs were more efficient vectors than adults. A minimum of thirty numbers were required for successful transmission of BSV. Plants inoculated with Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and in the case of Ferrisia virgata (Cockerell), it was six weeks. Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug has any role in the transmission of BSV. It was found that Geococcus sp. could not transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of Banana bunchy top disease had no role in the transmission of the virus. The studies on the transmission of the BSV through planting material proved that BSV is naturally transmitted through the planting materials of banana. PCR based molecular diagnosis is one of the reliable and quick method for the virus indexing of planting materials. The molecular diagnosis of BSV using polymerase chain reaction from infected samples was standardized using specific primers, (BSV 5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5' GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could be done directly from the crude sap, avoiding the step of DNA isolation. The outcome of this study will facilitate early detection and elimination of BSV infected plants and ensure distribution of healthy planting materials both suckers and tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well as the productivity of banana in the state.
Open Access
Potential of fortified spent mushroom substrate for the management of soil borne diseases of tomato
(Department of plant pathology, College of horticulture,Vellanikkara, 2015) Arathikrishna, V K; KAU; Sheela Paul, T
Mushrooms are produced on natural materials taken from agricultural waste. SMS is the substrate left after harvesting of mushroom fruit bodies. SMS contains a diverse range of soil microorganisms. This is proven by its disease suppressing properties and its effectiveness in bioremediation. Additions of microorganisms to soil ultimately enhance and accelerate regular soil process such as nutrient mobilization. Among the beneficial uses of SMS the disease controlling property is quite interesting. Tomato is one of the most widely used vegetable. The bacterial wilt and damping off are the two serious soil borne diseases of this crop. The management of diseases using chemicals is not safer to environment due to residual problem. Increasing concern regarding food safety and environmental pollution has generated an interest in eco friendly practices like soil amendment and application of biocontrol agents to manage the plant diseases. Under these circumstances this study was taken up to assess nutritional and disease management aspects of fortified SMS in tomato The antagonists used for this study like Trichoderma hamatum, T. viride and Bacillus subtilis are the isolates from SMS obtained from the previous studies conducted in the Department of Plant Pathology along with reference cultures of Kerala Agricultural University viz. T. viride and Pseudomonas fluorescens. They were evaluated against major soil borne fungal pathogens like Pythium aphanidermatum, Phytophthora palmivora, Fusarium oxysporum, Rhizoctonia solani and Sclerotium rolfsii and bacterial pathogen Ralstonia solanacearum of tomato. The in vitro evaluation showed that T. hamatum was the best among three fungal antagonists. While in case of bacteria P. fluorescens was the best. A microbial consortium of these two organisms was also prepared. The selected best antagonists and consortium were applied to SMS @ 300 ml per kg and kept for biosoftening for 60 days. The fortified SMS with P. fluorescens softened the SMS to a certain level. The primary nutrients like N, P, K, secondary nutrient Ca and micro nutrient Cu were found to be decreased as the time increases. In the pot culture experiment for the management of damping off, the treatment SMS fortified with consortium gave maximum per cent inhibition against the disease. In the management of bacterial wilt also SMS fortified with consortium found to be best in disease suppression as well as plant growth promotion. All the treatments with SMS were found to posses disease management property and enhance the plant growth. From this study it is clear that fortified SMS paves a new way in disease management. For confirmative result, elaborative field study has to be conducted and the quality of SMS has to be worked out.

Theses

Browse

Thesis Type

Type

Author

Date

Subject

Search Results