Theses

Browse

Search Results

Now showing 1 - 9 of 10

Open Access
Symptomatology and molecular diagnosis of banana streak virus disease.
(Department of Plant Pathology ,College of Horticulture, Vellanikkara, 2011) Divya, C R; KAU; Anitha Cherian, K
The banana (Musa spp.) is a crop of global importance in terms of income security to million of small farmers throughout the developing countries. It is the world's fourth most important commodity after rice, wheat and corn and is produced in tropical and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria and viruses. Among the viral diseases, Banana streak is now emerging as a major disease affecting banana production world wide. This disease assumes significance as it affects plant growth, fruit yield and quality. It is also causing problems to germplasm exchange and in the certification of in vitro plantlets for international trade. The present project was undertaken to study the symptomatology of Banana streak disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of Banana streak virus, to standardize molecular indexing of planting materials of banana and to identify the source of resistance in the field gene bank. The symptoms of the disease appeared on different parts of the plant such as leaf lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later turned necrotic, blackened and running perpendicular to the leaf axis extending from midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina especially on older leaves. Dark brown coloured linear lesions appeared on other parts like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and death of cigar leaf was noticed. The plants showing such symptoms did not flower and resulted in 100 percent yield loss. The impact of the disease on biometric and yield characters was studied and observed that the disease affected the growth and yield of banana. A significant correlation was observed between the expression of symptoms with rainfall and temperature. The expression of the symptoms was more in cooler months and less in summer. The field gene bank comprising 290 accessions maintained at BRS, Kannara was screened to assess the reaction of these accessions to the disease. The disease incidence was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB), Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3 (AAAB). The percent disease incidence ranged from13.25 to 32.16 . The transmission studies proved that BSV was not transmitted mechanically or through infected soil. The insect vectors of BSV were proved to be two species of mealy bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The studies on virus vector relationship of these mealy bugs showed that the maximum acquisition feeding period, pre-acquisition fasting period, inoculation access period required for successful transmission were three days, one hours and seven hours respectively. The nymphs were more efficient vectors than adults. A minimum of thirty numbers were required for successful transmission of BSV. Plants inoculated with Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and in the case of Ferrisia virgata (Cockerell), it was six weeks. Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug has any role in the transmission of BSV. It was found that Geococcus sp. could not transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of Banana bunchy top disease had no role in the transmission of the virus. The studies on the transmission of the BSV through planting material proved that BSV is naturally transmitted through the planting materials of banana. PCR based molecular diagnosis is one of the reliable and quick method for the virus indexing of planting materials. The molecular diagnosis of BSV using polymerase chain reaction from infected samples was standardized using specific primers, (BSV 5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5' GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could be done directly from the crude sap, avoiding the step of DNA isolation. The outcome of this study will facilitate early detection and elimination of BSV infected plants and ensure distribution of healthy planting materials both suckers and tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well as the productivity of banana in the state.
Open Access
Endophytic microorganism mediated systemic resistance in Cocoa against Phytophthora palmivora (Butler) Butler
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Sainamole Kurian, P; KAU; Koshy Abraham
The study on 'Endophytic microorganism mediated systemic resistance in cocoa against Phytophthora palmivora (Butler) Butler was carried out during 2005-2010. The pathogen causing pod rot of cocoa was isolated from infected pods , and its pathogenicity established. Based on cultural and morphological characters, it was identified as Phytophthora palmivora (Butler) Butler. Endophytes were isolated from samples of feeder roots, tender shoots, leaves and pods of cocoa collected from various locations of major cocoa growing area of the state. The population of endophytic microflora varied among different locations and parts of the plant, and in general, the population was more in roots. Bacteriaand fluroscent pseudomonads were more abundant than filamentous fungi and yeasts. Out of the 325 endophytic isolates comprising of 116 bacteria, 153 fluorescent pseudomonads, 34 years and 22 fungi, 82 were found exerting antogonism towards the pathogen. These antagonistic endophytes were further evaluated in In vitro by dual culture and by inoculation on detached cocoa pods, and leaves. It was found that, 25 isolates were more efficient antagonists.
Open Access
Foliar fungal pathogens associated with yellowing disease of coconut.
(Department of Plant Pathology, College of Agriculture, Vellayani, 2011) Anju, C; Suharban, M
The study entitled ‘Foliar fungal pathogens associated with yellowing disease of coconut’ was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani. A detailed survey was undertaken to study the incidence and intensity of Root (Wilt) Disease and Yellowing disease in the Instructional Farm, Vellayani. Both the diseases were observed in all the six blocks of the Farm. Out of 6107 palms in the farm 561 palms were affected by Root (Wilt) Disease (9.19 %) and 127 palms (2.08%) were showing symptoms of Yellowing disease. A total of 242 (43%) Root (Wilt) affected palms and 94 (74%) Yellowing disease affected palms are to be cut and removed since they are unproductive. The characteristic symptoms of Root (Wilt) Disease were flaccidity, ribbing, yellowing and necrosis. The Root (Wilt) Disease affected palms (42%) were ‘super infected’ with leaf rot disease also. In Yellowing Disease affected palms sudden appearance of chlorosis/ yellowing/ bronzing of one or more leaves in the middle whorl coupled with flaccidity was the characteristic symptom. Rapid drying and necrosis of inflorescence, abnormal shedding of flowers, buttons, immature nuts and mature nuts occurred in succession either simultaneously or prior to yellowing and the palms became barren within a short period. On the chlorotic/ yellowed leaves intense brown to black leaf spots developed which enlarged, coalesced together and blighted the leaflets. The affected palms usually succumb within a short span of time. Foliar fungal pathogens associated with leaf spots/ blights on the symptomatic leaves of Yellowing disease affected palms were isolated and the pathogenicity was proved. On artificial inoculation on detached spindle as well as mature leaflets, the pathogens produced tiny brown water soaked lesions of angular or oval or irregular shapes. Among the different pathogens Chalara fimbriata was the most virulent one. Based on the morphological and cultural characteristics the following foliar fungal pathogens on Yellowing disease affected palms were identified: Alternaria alternata, Aspergillus niger, Colletotrichum gloeosporioides, Cephalosporium spp., Chalara fimbriata, Curvularia spp., Fusarium verticillioides, F. semitectum, Lasiodiplodia theobromae, Pestalotiopsis maculans, Pestalotiopsis palmarum, Phomopsis spp., Arthrinium spp. and Verticillium spp. Among them, L. theobromae, C. gloeosporioides and P. maculans were the most frequently isolated pathogens. The biochemical analysis revealed that total sugars, total soluble proteins and phenylalanine ammonia lyase activity were higher in the leaves of diseased palms. Among the nine fungicides tested in vitro, Propiconazole, Tebuconazole and Mancozeb were found to be equally effective against L. theobromae, C. gloeosporioides, P. maculans and F. verticillioides.
Open Access
Studies on transmission, host range and management of ash gourd mosaic disease.
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Divya, M; KAU; Vimi, Louis
The present investigation, “Studies on transmission, host range and management of ash gourd mosaic disease” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-2011 with an aim to study the symptomatology of the mosaic disease, mode of transmission, host range of the virus, the resistance of available genotypes to mosaic under net house conditions and to evolve a suitable management practice under field conditions. The sampling survey for the collection of mosaic samples conducted in different locations of Thrissur district revealed the incidence of five types of mosaic symptoms viz., marginal yellowing, yellow-green patch, severe puckering, filiform type and light and dark green patch type on ash gourd leaves. The marginal yellowing was found to be the prominent type of symptom compared to the other four types of mosaic. Under natural condition, yellowing of leaf margin was the major symptom of marginal yellowing type mosaic. But under artificial condition, yellowing of veins and veinlets of the leaf starting from the margin was the prominent symptom. In sap transmission studies, citrate phosphate buffer (0.1 M, pH 7) gave maximum disease incidence (73 per cent) with 23-28 days of incubation. In vector transmission studies, Aphis gossypii gave 59.5 per cent disease incidence and Bemisia tabaci, was unable to transmit the virus. Biological indexing was done on Petunia hybrida and Vigna unguiculata to identify different viruses infecting ash gourd. Dark necrotic spot was produced in P. hybrida on inoculation with yellow-green patch type and severe puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Chlorotic spots were produced in V. unguiculata on inoculation with yellow-green patch type and puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Symptoms were not produced on inoculation with marginal yellowing type in P. hybrida and V. unguiculata. Based on the symptoms produced on V. unguiculata, it was ascertained that the virus causing yellow-green patch type mosaic belong to Cucumber mosaic virus group and the virus causing filiform type of mosaic belong to potyvirus group. The electron microscopic study of the marginal yellowing type and puckering type revealed that they also belong to potyvirus group. Host range studies of the ash gourd mosaic revealed systemic infection in snake gourd, bottle gourd, ivy gourd, tomato, chilli and cluster bean. Screening of 15 ash gourd genotypes against mosaic disease, revealed that one genotype, Jeevas was resistant to the mosaic with no disease incidence and one genotype BH-205 was moderately resistant (10 per cent incidence). The genotypes BH-206, BH-210, Indu, BHF-2, BHF-3, BHF-4, BHF-6, BHF-7, BHF-8 and BHF-9 were moderately susceptible (20-50 per cent incidence) and BH-216, BH-219 and BHF-5 were susceptible (70 per cent incidence) to mosaic. Field experiment conducted to evaluate the effect of botanicals, biocontrol agent and chemicals on ash gourd mosaic revealed that all treatments reduced disease incidence, severity and coefficient of infection and increased yield and among them quinalphos (0.05%) was the best. From the above study, it was concluded that marginal yellowing, yellow-green patch, puckering and filiformy were the major types of ash gourd mosaic and among them, mosaic with marginal yellowing symptom was the prominent one. The ash gourd mosaic was transmissible through sap and aphid. The virus causing marginal yellowing type mosaic belonged to potyvirus group. Snake gourd, bottle gourd, coccinia, tomato, chilli and cluster bean were found to be collateral hosts of the virus. Jeevas, a local genotype was identified as a resistant variety to ash gourd mosaic. The results of field experiment revealed that quinalphos (0.05 per cent) showed maximum effect in reducing mosaic infection.
Open Access
Bioefficacy of endophytic actinomycetes on plant growth promotion and management of bacterial wilt in tomato.
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Sreeja, S J; KAU; Surendra Gopal, K
The present study on ‘‘Bioefficacy of endophytic actinomycetes on plant growth promotion and management of bacterial wilt in tomato” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-11.The main objectives were to isolate endophytic actinomycetes from healthy tomato plants collected from five different locations, to study the antagonistic effect of those endophytic actinomycetes against bacterial wilt pathogen under in vitro conditions and their evaluation against bacterial wilt pathogen under pot culture experiment. Endophytic actinomycetes were isolated from tomato plants in Vellanikkara, Cherumkuzhy, Elanad (Thrissur district), Ozhalapathy and Eruthenpathy (Palakkad district). Only a single type of isolate was obtained from the different locations. The population was maximum in the roots of sample collected from Cherumkuzhy (EACK) (8x101 cfu/g) followed by Eruthenpathy (EAET) (3x101 cfu/g). The least count of endophytic actinomycetes was obtained from Vellanikkara (EAVK), Elanad (EAEN) and Ozhalapathy (EAOP) (1 x101 cfu/g). The pathogen causing bacterial wilt in tomato was circular, smooth, convex, slimy, fluidal, creamy white colonies with light pink centre indicating its identity as Ralstonia solanacearum. The efficacy of endophytic actinomycetes against R.solanacearum was evaluated under in vitro conditions. Out of the five isolates, maximum inhibition of the pathogen was observed with the Vellanikkara isolate (EAVK) (29.25%) which was on par with Ozhalapathy isolate (EAOP) (22.59%). The efficacy of culture filtrate of endophytic actinomycetes against R.solanacearum was also evaluated under in vitro conditions. Among the isolates, maximum inhibition of the pathogen was recorded with the Cherumkuzhy isolate (EACK) (44.63%) which was on par with Ozhalapathy isolate (EAOP) (42.59%). Based on the dual culture method and the effect of culture filtrate of antagonists, EAOP was found to be the best isolate under in vitro conditions. The morphological and cultural characters of endophytic actinomycetes were studied based on standard keys and the isolates were tentatively identified as Streptomyces. Among the isolates, EAOP produced the maximum concentration of IAA (73.1 µg/ml) followed by EACK (41.8 µg/ml) and the least was produced by EAVK (3.2 µg/ml). The mechanism of action of endophytic actinomycetes was studied based on the production of siderophores, HCN, ammonia and non-volatile metabolites by the isolates. The siderophore production was maximum in EAOP isolate followed by EAVK isolate and the least was produced by EACK isolate. None of the isolates were able to produce hydrogen cyanide. Maximum ammonia production was shown by EAVK, EACK and EAET isolates. All the isolates were able to produce non- volatile metabolites. Evaluation of endophytic actinomycetes against bacterial wilt pathogen was carried out under pot culture conditions. Minimum per cent wilt incidence was shown by plants in pots treated with urea (44 g m-2) and lime (500 g m-2) (T6) (29.63%) and it differed significantly from the other treatments. Among the endophytes, the plants treated with EAOP (T4) isolate showed minimum per cent wilt incidence (37.03%). The minimum per cent wilt index was also recorded with urea and lime (25.9%), followed by EAOP isolate (36.3%). Among the endophytic actinomycetes, EAOP was the most promising isolate for the management of bacterial wilt in disease. The efficiency of endophytic actinomycetes in plant growth promotion was assessed under pot culture experiment. The plant height was maximum in plants treated with EA OP isolate (77.31 cm). The plants treated with EAEN isolate took the minimum number of days for flowering (34.83 DAP) where as the plants treated with EAVK isolate took the minimum number of days to first harvest (81.66 DAP). Plants treated with EAET isolate produced the maximum number of fruits per plant (17.57) and the plants treated with EAOP isolate produced fruits with maximum weight (20.30 g). Highest yield was recorded for the plants treated with EAET isolate (332.02 g/plant) and the lowest yield was for the control plants. It was observed from the study that EAOP and EAET were the promising isolates in plant growth promotion. The five isolates were identified by National Center for Fungal Taxonomy (NCFT), New Delhi, based on their morphological and cultural characters as Streptomyces glaucescens (EAVK), Streptomyces griseoruber (EACK), Streptomyces griseous (EAEN), Streptomyces thermodiastaticus (EAOP) and Streptomyces griseolus (EAET). The identity of three efficient isolates (EAOP, EAET and EACK) obtained under pot culture experiment were further confirmed by 16S rRNA sequence analysis using PCR. The present studies indicated that the Ozhalapathy isolate (EAOP) (Streptomyces thermodiastaticus) was the most efficient among the five isolates of endophytic actinomycetes in plant growth promotion as well as in the management of bacterial wilt in tomato.
Open Access
Ecofriendly management for fruit rot of chilli (Capsicum Annuum L.) caused by colletotrichum spp.
(Department of Plant Pathology, College of Agriculture, Vellayani, 2010) Golda, S B; KAU; Mary, C A
Chilli belonging to the family Solanaceae having Mexican centre of origin is an important spice cum vegetable crop grown for its pungent fruits. Besides being a rich source of spicy flavour and colour, they are free of cholesterol, low in sodium, rich in vitamin A, C, E, folic acid and potassium. India is a major producer, exporter and consumer of chilli. The area and production of chilli in the country is 7.57 lakh ha and 11.67 lakh tonnes. In Kerala, the area under cultivation is 14,000 ha with a productivity of 1000 Kg/ha. Chilli anthracnose / fruit rot was first reported in India by Sydow in the year 1913 from Coimbatore of erst while Madras Presidency. Anthracnose occurs both as pre harvest and post harvest decay of mature fruits and account for more than 50 % of the crop losses. Since 1940, chemical fungicides were used for the control of chilli diseases. The indiscriminate usage of a wide range of fungicides has invited many undesirable problems such as development of fungal resistance, toxic residues in the produce, environmental pollution and escalating costs in vegetable production. So there is an urgent need to find out an effective, alternative methods of disease control, which was less harmful to human beings and environment. The objective of the present investigation was to evolve an ecofriendly management strategy to control fruit rot of chilli using biocontrol agents, plant extracts and plant products. The study involves symptomatology of the disease under natural and artificial conditions. In both the situations, symptoms appeared as small brown sunken circular necrotic lesions with concentric rings of acervuli. The lesions enlarged elliptically and the fruit get shrivelled. During the present investigation, two species of Colletotrichum viz., C. gloeosporioides and C. capsici were isolated and the pathogenicity of the disease was proved. Conidial, morphological and cultural characters of both the organisms were studied. Conidia of C. gloeosporioides were cylindrical, straight with obtuse ends whereas that of C. capsici were falcate. Growth in different solid and liquid media, carbon sources, nitrogen sources, temperature and pH were studied. Best solid medium for the growth of C. gloeosporioides was Richards’ Agar whereas the best liquid medium was Richards’ broth, best carbon source - sucrose, best nitrogen source - Asparagine, best inorganic source - Potassium nitrate, optimum temperature 30˚С and optimum pH 6.0. Fungal antagonists obtained from the chilli phyllosphere were Penicillium sp., Aspergillus niger and from the rhizosphere Trichoderma harzianum, Gliocladium virens, Aspergillus flavus. Bacterial antagonists obtained from the rhizosphere was Bacillus sp. and Pseudomonas fluorescens. The best antagonist obtained under in vitro screening by dual culture technique T. harzianum, was selected for the in vivo study. Talc based formulation of T. harzianum was made and its shelf life was found to be more than 180 days. Leaf extracts at 60, 80 and 100 % concentrations from Piper betle, Ocimum sanctum, Azadirachta indica, Lantana camara, Datura stramonium, Andrographis paniculata and Bougainvillea glabra were tested against C. gloeosporioides under in vitro conditions by poisoned food technique and maximum inhibition of the pathogen was obtained in Datura stramonium at 80 and 100 % concentration. Lower concentrations of Datura stramonium were also tested (40, 20, 10 and 5 %) and it was found that as the concentration decreases, its effect is also found decreasing. Among the plant products viz., Turmeric powder, Garlic bulb extract, Neem Seed Kernel Extract and Neem oil tested against the pathogen, highest inhibition was obtained from Garlic bulb extract at 10 % concentration. Combinations of the biocontrol agent, plant extract and plant product were tested against the pathogen and it was observed that T. harzianum (1 %) + Datura stramonium (20 %) + Garlic bulb extract (10 %) completely inhibited the growth of C. gloeosporioides. Five chilli varieties released from KAU were screened against the disease and found that none of the varieties were found immune to the disease and the variety Vellayani Athulya was found to be the most susceptible one. This variety was selected for the in vivo management trial. For in vivo management of fruit rot of chilli a pot culture experiment in CRD with four replications and nine treatments was laid out at College of Agriculture, Vellayani. The treatments used were T. harzianum (1 %), Datura stramonium (20 %), Garlic bulb extract (10 %) individually and in combinations with standard fungicidal check Bavistin @ 0.05 % and unsprayed control. The variety Vellayani Athulya was used for the in vivo experiment. Among the treatments seedling dip with talc based formulation of T. harzianum 500 g per 1000 ml of water for 20 min. and two foliar sprays at five days interval with a combination of talc based formulation of T. harzianum @ 1 % + Datura stramonium leaf extract @ 20 % + Garlic bulb extract @ 10 % was found best for the management of fruit rot of chilli caused by C. gloeosporioides.
Open Access
Normal view MARC view ISBD view Foliar fungal pathogens associated with yellowing disease of coconut
(College of Agriculture, Vellayani, 2011) Anju, C; KAU; Suharban, M
The study entitled ‘Foliar fungal pathogens associated with yellowing disease of coconut’ was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani. A detailed survey was undertaken to study the incidence and intensity of Root (Wilt) Disease and Yellowing disease in the Instructional Farm, Vellayani. Both the diseases were observed in all the six blocks of the Farm. Out of 6107 palms in the farm 561 palms were affected by Root (Wilt) Disease (9.19 %) and 127 palms (2.08%) were showing symptoms of Yellowing disease. A total of 242 (43%) Root (Wilt) affected palms and 94 (74%) Yellowing disease affected palms are to be cut and removed since they are unproductive. The characteristic symptoms of Root (Wilt) Disease were flaccidity, ribbing, yellowing and necrosis. The Root (Wilt) Disease affected palms (42%) were ‘super infected’ with leaf rot disease also. In Yellowing Disease affected palms sudden appearance of chlorosis/ yellowing/ bronzing of one or more leaves in the middle whorl coupled with flaccidity was the characteristic symptom. Rapid drying and necrosis of inflorescence, abnormal shedding of flowers, buttons, immature nuts and mature nuts occurred in succession either simultaneously or prior to yellowing and the palms became barren within a short period. On the chlorotic/ yellowed leaves intense brown to black leaf spots developed which enlarged, coalesced together and blighted the leaflets. The affected palms usually succumb within a short span of time. Foliar fungal pathogens associated with leaf spots/ blights on the symptomatic leaves of Yellowing disease affected palms were isolated and the pathogenicity was proved. On artificial inoculation on detached spindle as well as mature leaflets, the pathogens produced tiny brown water soaked lesions of angular or oval or irregular shapes. Among the different pathogens Chalara fimbriata was the most virulent one. Based on the morphological and cultural characteristics the following foliar fungal pathogens on Yellowing disease affected palms were identified: Alternaria alternata, Aspergillus niger, Colletotrichum gloeosporioides, Cephalosporium spp., Chalara fimbriata, Curvularia spp., Fusarium verticillioides, F. semitectum, Lasiodiplodia theobromae, Pestalotiopsis maculans, Pestalotiopsis palmarum, Phomopsis spp., Arthrinium spp. and Verticillium spp. Among them, L. theobromae, C. gloeosporioides and P. maculans were the most frequently isolated pathogens. The biochemical analysis revealed that total sugars, total soluble proteins and phenylalanine ammonia lyase activity were higher in the leaves of diseased palms. Among the nine fungicides tested in vitro, Propiconazole, Tebuconazole and Mancozeb were found to be equally effective against L. theobromae, C. gloeosporioides, P. maculans and F. verticillioides.
Open Access
Management of phomopsis blight and fruit rot of brinjal (Solanum Melongena L.)
(College of Agriculture, Vellayani, 2011) Lakshmi Nair, P; KAU; Sulochana, K K
Brinjal or Eggplant (Solanum melongena L.), an important vegetable crop belonging to the family Solanaceae is grown for its fruits. Due to it’s versatality in use in Indian diet, brinjal is described as the ‘King of vegetables’ (Choudhary and Gaur, 2009). Such a potential crop is known to suffer from many diseases including damping off, seedling blight fruit rot etc caused by Phomopsis vexans, Fusarium sp, Rhizoctonia solani, Sclerotium rolfsii, Phytophthora capsici etc. These diseases cause crop loss up to 30-50 % (Masuduzzaman et al., 2008). In the organic era of cultivation of crops, use of chemical means of disease management is having least significance. In this context, an ecofriendly management strategy for the management of Phomopsis blight and fruit rot in brinjal was taken up. Brinjal fruits showing the typical symptom of fruit rot were collected from different blocks of College of Agriculture, Vellayani, isolated and identified as Phomopsis vexans. Its’ pathogenicity was proved following Kochs’ Postulates. Symptomatology studies of the disease under natural and artificial conditions were studied. Under both the situations symptoms appeared almost similar. The symptoms first appeared as pale, sunken, circular to oval areas on the fruit surface. Affected fruits became soft and watery at first; decay penetrated rapidly throughout the fruit, causing a light-brown discoloration of the flesh. Under dry conditions, fruits get shrivelled and became mummified. Black pycnidia arranged in a concentric pattern can generally be seen. Cultural and morphological study of the pathogen were also done. Cultural and morphological characters of the pathogen was studied on PDA. Both types of conidia - Alpha and Beta conidia are produced by the pathogen. Four different media were tested, viz., Potato Dextrose medium, Czapek’s Dox medium, Host Extract Dextrose medium and Oat Meal medium. Best solid medium for the growth of Phomopsis vexans was PDA whereas the best liquid medium was Czapek’s Dox broth. Growth of the pathogen was also tested in different pH from 5.0 to 9.0 and optimum pH for the growth of the pathogen was found as 8.0. Five different carbon sources were tested, viz., dextrose, lactose, maltose, starch and sucrose. Among these lactose was found as the best carbon source for the growth. The different nitrogen sources tried were ammonium carbonate, ammonium chloride, ammonium nitrate, potassium nitrate and sodium nitrate. Among them sodium nitrate was found to be the best. During the isolation of antagonists from phyllosphere and rhizosphere of brinjal plants many organisms were obtained. Among them the fungal antagonists selected were Trichoderma sp. and Aspergillus sp. The bacterial isolates selected for the inhibition studies of the pathogen were B1 and fluorescent bacterial isolate (FB – 2). These were further evaluated under laboratory conditions and fluorescent bacterial isolate (FB - 2) was found to show the maximum suppression of the pathogen. In vitro screening of bio control agents/plant extracts/oil cakes were also tested against the pathogen. The best antagonist obtained under in vitro screening by dual culture technique, was fluorescent bacterial isolate. Leaf extracts at 20 and 30 per cent concentrations from Ocimum sanctum, Azadirachta indica, Lantana camara and Clerodendron oderatum were tested against Phomopsis vexans under in vitro conditions by poisoned food technique and maximum inhibition of the pathogen was obtained in Ocimum sanctum at 20 and 30 per cent concentration. Among the oil cakes viz., coconut oil cake, gingelly oil cake, neem cake and groundnut oil cake tested against the pathogen, highest inhibition was obtained from ground nut oil cake. The selected treatments from the in vitro tests were subjected to in vivo screening. For this a pot culture experiment in CRD with three replications and nine treatments were laid out in the College of Agriculture, Vellayani. The treatments used were fluorescent bacterial isolate (2 %), Ocimum sanctum leaf extract (20 %), ground nut oil cake (200 g/pot) individually and in combinations with standard fungicidal check carbendazim 0.1 per cent and inoculated control. The variety Swetha was used for the in vivo experiment. Application of soil amendment with groundnut oil cake (200 g/pot), seedling root dip with talc based formulation of fluorescent bacterial isolate, FB - 2 (2 %) for 20 min. and foliar sprays with a combination of talc based formulation of fluorescent bacteria (2 %) + Ocimum sanctum leaf extract (20 %) was found to be the best for the management of Phomopsis blight and fruit rot disease of brinjal.
Open Access
Phenotypic and pathogenic variability of sclerotium rolfsii sacc. infecting fruit crops and ornamentals
(College of Horticulture, Vellanikkara, 2011) Hajara, P H; KAU; Beena, S
The present study on “Phenotypic and pathogenic variability of Sclerotium rolfsii Sacc. infecting fruit crops and ornamentals” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-2011 with an aim to isolate the pathogen associated with the disease and to study the symptomatology of the disease, variability in phenotypic and pathogenic characters of isolates, compatibility of the different isolates, host range of the pathogen and estimation of IAA and total phenol content in mycelia, culture filtrate and sclerotia. Isolation of pathogen associated with the diseased specimens of selected ornamental plants viz., marigold and chrysanthemum and fruit crops viz., mango and banana yielded a total of 11 isolates of S. rolfsii from different locations. Among them, two isolates from marigold (MG-1, MG-2), four from chrysanthemum (CH-1, CH-2, CH-3, CH-4), three from mango (MN-1, MN-2, MN-3) and two from banana (BA-1 and BA-2) were obtained. The pathogenicity of the isolates was proved by artificial inoculation on their respective host. Symptomatology of disease revealed slight variation in the symptoms produced by the pathogen in different host plants. In marigold and chrysanthemum infection was observed on leaves and collar region. Flowers of marigold were also infected by the pathogen. Mango seedlings and grafts were infected by the pathogen on the collar region. In banana var. Kadali, infection was observed on pseudostem at the base of leaf petiole and pseudostem broken at the point of infection. Dark brown water soaked lesions were present on infected areas of all the plants. Later it was covered with thick white mycelial growth and brown sclerotia. Detailed study on the phenotypic characters of the isolates revealed variations in the cultural and morphological characters. All the isolates produced white coloured colony on all the selected media. Variation in the texture and type of mycelium, sclerotial initiation and maturation, number, position, weight of 100 sclerotia and production of exudates was recorded. Among the different media tested, Potato Dextrose Agar was found to be the best medium for the growth of pathogen. In all the isolates, hyphae are hyaline, branched, septate and the hyphal cell size 52.6-196.32 μm×4.25-8.93 μm. Sclerotia were dark brown, smooth and spherical, 0.5-2.00 mm diameter in size. The maximum size of sclerotia was recorded in MN-2 and minimum in BA-2. Cluster analysis of cultural and morphological characters revealed a degree of variability among the isolates. The lowest dissimilarity index was noticed between isolates CH-1 and BA-2. The isolates viz., MG-1, MG-2, CH-1, CH-2, CH-3, CH-4, MN-1 and MN-2 were found more similar and were grouped under the sub cluster A1 of cluster A. The isolates from banana stands separate and showed more dissimilarity with all other isolates. Mycelial compatibility between the different isolates of S. rolfsii was tested by dual culture method. Out of 55 combinations, eight Mycelial Compatibility Groups (MCG‟s) were identified. In the compatible reactions, intermingling of the mycelia and sclerotial formation was noticed at the site of interaction between isolates. Complete overgrowth of the mycelium of two isolates was not observed in compatible reactions. The isolates produced sclerotia with exudates in a line at site of interaction between the isolates. Sclerotial formation on the surface of both the cultures was also noticed. In the incompatible reactions, formation of inhibition zone of size 0.2 - 2.6 mm and development of sclerotia on either side of inhibition zone were observed. From the study, it was clear that the virulent isolate from marigold (MG-2) showed mycelial compatibility with virulent isolates from chrysanthemum (CH-2), mango (MN-2) and banana (BA-2). Cross inoculation studies revealed that all the isolates were pathogenic to other hosts but variation in the pathogenic character of these isolates was observed. Variation in the symptom expression was not noticed on the inoculated plants by different isolates obtained from the same host. All the isolates produced infection on the leaves of other hosts, but failed to produce collar infection on mango seedlings. The isolates BA-1 and BA-2 did not initiate infection on collar region of chrysanthemum. It was concluded that different isolates of S.rolfsii obtained from the selected fruit crops and ornamental plants showed variability in their pathogenic character. Host range of S. rolfsii was studied by cross inoculating different isolates of S. rolfsii on selected vegetables viz., tomato, amorphophallus and spices viz., black pepper, ginger. All the plants tested were found susceptible to the pathogen. Symptom appeared as small, water soaked brown discolouration on the inoculated leaves and collar region. Later it enlarged in size and covered with white mycelial growth of the pathogen in all the hosts except in the collar region of amorphophallus inoculated with MG-2 and MN-2. It was also observed that the initial infection was first noticed on leaves and collar region where pinprick have been given before inoculation. Variation among the isolates was observed in the production of sclerotia and was noticed that sclerotial development was completely absent in ginger and tomato on both the leaves and collar region. On the leaves of black pepper, white mycelial growth and sclerotial formation were noticed on the lower side of the leaves. The isolate BA-2 produced concentric zonations on the inoculated leaves of pepper. Estimation of IAA and total phenol in mycelia, culture filtrate and sclerotia of various isolates revealed that all the isolates produced highest IAA and total phenol in the sclerotia. Among the isolates, MG-1 and MG-2 recorded the highest IAA and total phenol in mycelia, culture filtrate and scloerotia of various isolates of the pathogen respectively.

Theses

Browse

Thesis Type

Type

Author

Date

Subject

Search Results