Loading...
Thumbnail Image

Theses

Browse

Search Results

Now showing 1 - 9 of 14
  • ThesisItemOpen Access
    Characterization and management of ganoderma lucidum inciting basal stem rot of coconut
    (Department of Plant Pathology, College of Horticulture, Vellanikkara, 2012) Yunus, C; KAU; Beena, S
    The present study on “ Characterization and management of Ganoderma lucidum inciting basal stem rot of coconut ” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2010-2012 with an aim to isolate the pathogen associated with the disease and to study the cultural, morphological and pathogenic characters of different isolates of the pathogen, symptomatology of the disease, host range and effective management of the pathogen using bio-control agents, phytoextracts and selected fungicides. Purposive sampling surveys were conducted and the occurrence of basal stem rot disease of coconut was observed through out Kerala. The isolation of pathogen from basidiocarps yielded eight isolates of Ganoderma sp. which produced fruiting body in saw dust- rice bran substrate. The pathogenicity of these isolates was tested and observed yellowing, drying and drooping of leaves of coconut seedlings inoculated with all isolates except the isolate GT- from Trivandrum. Basidiocarp formation was noticed only in one seedling inoculated with the isolate GV from Vellayani and reisolation of pathogen was done from this basidiocarp. Symptomatology of the disease under natural and artificial conditions was studied. Under field condition the typical symptom of BSR disease viz., yellowing and drooping of leaves, stem bleeding and basidiocarp formaton were observed in all surveyed areas but all the typical symptoms of disease were not observed under artificial condition. The cultural characters of all the isolates of pathogen were studied on four media viz., Potato dextrose agar, Czapek’s (DOX) agar, Richard’s agar and Soil extract agar media. All isolates produced white mycelial growth on all media but variations in texture, mycelial type, and colour change of mycelium, exudates production and formation of aberrant fruiting body were observed. PDA was found to be the best medium for the growth of pathogen in which all isolates recorded highest growth rate. The pathogen preferred a temperature range of 30-350C and neutral to acid pH of 5-7 for the growth. Slight variation in growth rate was observed under light and darkness. Basidiocarps showed variations in the morphological characters and were stipitate in all isolates except GC from Chirakkacode and GVe from Vettikkal, semicircular to conical shaped, yellowish red to reddish brown with smooth to waved margin, creamy white to brown pore surface, 4.4 – 12.0 x 2.6- 17.0 cm size, 1-10 mm pore length, 139- 254 x 122 – 190 μm pore diameter and 2-10 mm flesh thickness. Basidiospores were brown, ovate to ellipsoidal, truncated apex, double walled with inter wall pillars separating two walls. The size of these basidiospores showed variation in the range of 4.8-13 x 4.5-7.0μm with a spore index of 1.15-1.7. It was trimitic, with generative hyphae hyaline, thin walled, branched, septate and clamped. Reddish brown pigmented skeletal hyphae and colourless binding hyphae were noticed. Based on these observations the eight isolates of the pathogen were identified as Ganoderma lucidum (Leys) Karst. Regarding the in vitro management of the pathogen, two isolates of T. virens and one isolate of T. viride were isolated from rhizophere soil and were proved equally effective with the reference culture, T. viride and T. harzianum in inhibiting the growth of pathogen. Mycoparasitism and production of non volatile metabolites were found to be the mechanisms exhibited by the selected Trichoderma spp. The bacterial antagonists obtained from rhizosphere soil and the reference culture P. fluorescens recorded less than 50 percent inhibition on the growth except in cases of few isolates of the pathogen. It was observed that the selected bacterial antagonists were not much effective in inhibiting the pathogen compared to fungal antagonists. Among the phytoextracts, Azadirachta indica at 20 per cent concentration was found the most effective and recorded more than 50 percent inhibition on the growth of pathogen over control. It was followed by Musa sp. at 10 per cent concentration. The in vitro evaluation of fungicides showed that flusilazole, hexaconazole and iprobenphos at 0.2 per cent concentration were the most effective and recorded cent per cent inhibition on the growth of all isolates of pathogen. The study on the host range of G. lucidium revealed that the seedlings of arecanut, breadfruit, acacia and jack fruit showed yellowing and drooping of leaves and finally wilting of all the seedlings were observed
  • ThesisItemOpen Access
    Symptomatology and molecular diagnosis of banana streak virus disease.
    (Department of Plant Pathology ,College of Horticulture, Vellanikkara, 2011) Divya, C R; KAU; Anitha Cherian, K
    The banana (Musa spp.) is a crop of global importance in terms of income security to million of small farmers throughout the developing countries. It is the world's fourth most important commodity after rice, wheat and corn and is produced in tropical and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria and viruses. Among the viral diseases, Banana streak is now emerging as a major disease affecting banana production world wide. This disease assumes significance as it affects plant growth, fruit yield and quality. It is also causing problems to germplasm exchange and in the certification of in vitro plantlets for international trade. The present project was undertaken to study the symptomatology of Banana streak disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of Banana streak virus, to standardize molecular indexing of planting materials of banana and to identify the source of resistance in the field gene bank. The symptoms of the disease appeared on different parts of the plant such as leaf lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later turned necrotic, blackened and running perpendicular to the leaf axis extending from midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina especially on older leaves. Dark brown coloured linear lesions appeared on other parts like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and death of cigar leaf was noticed. The plants showing such symptoms did not flower and resulted in 100 percent yield loss. The impact of the disease on biometric and yield characters was studied and observed that the disease affected the growth and yield of banana. A significant correlation was observed between the expression of symptoms with rainfall and temperature. The expression of the symptoms was more in cooler months and less in summer. The field gene bank comprising 290 accessions maintained at BRS, Kannara was screened to assess the reaction of these accessions to the disease. The disease incidence was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB), Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3 (AAAB). The percent disease incidence ranged from13.25 to 32.16 . The transmission studies proved that BSV was not transmitted mechanically or through infected soil. The insect vectors of BSV were proved to be two species of mealy bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The studies on virus vector relationship of these mealy bugs showed that the maximum acquisition feeding period, pre-acquisition fasting period, inoculation access period required for successful transmission were three days, one hours and seven hours respectively. The nymphs were more efficient vectors than adults. A minimum of thirty numbers were required for successful transmission of BSV. Plants inoculated with Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and in the case of Ferrisia virgata (Cockerell), it was six weeks. Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug has any role in the transmission of BSV. It was found that Geococcus sp. could not transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of Banana bunchy top disease had no role in the transmission of the virus. The studies on the transmission of the BSV through planting material proved that BSV is naturally transmitted through the planting materials of banana. PCR based molecular diagnosis is one of the reliable and quick method for the virus indexing of planting materials. The molecular diagnosis of BSV using polymerase chain reaction from infected samples was standardized using specific primers, (BSV 5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5' GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could be done directly from the crude sap, avoiding the step of DNA isolation. The outcome of this study will facilitate early detection and elimination of BSV infected plants and ensure distribution of healthy planting materials both suckers and tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well as the productivity of banana in the state.
  • ThesisItemOpen Access
    Endophytic microorganism mediated systemic resistance in Cocoa against Phytophthora palmivora (Butler) Butler
    (Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Sainamole Kurian, P; KAU; Koshy Abraham
    The study on 'Endophytic microorganism mediated systemic resistance in cocoa against Phytophthora palmivora (Butler) Butler was carried out during 2005-2010. The pathogen causing pod rot of cocoa was isolated from infected pods , and its pathogenicity established. Based on cultural and morphological characters, it was identified as Phytophthora palmivora (Butler) Butler. Endophytes were isolated from samples of feeder roots, tender shoots, leaves and pods of cocoa collected from various locations of major cocoa growing area of the state. The population of endophytic microflora varied among different locations and parts of the plant, and in general, the population was more in roots. Bacteriaand fluroscent pseudomonads were more abundant than filamentous fungi and yeasts. Out of the 325 endophytic isolates comprising of 116 bacteria, 153 fluorescent pseudomonads, 34 years and 22 fungi, 82 were found exerting antogonism towards the pathogen. These antagonistic endophytes were further evaluated in In vitro by dual culture and by inoculation on detached cocoa pods, and leaves. It was found that, 25 isolates were more efficient antagonists.
  • ThesisItemOpen Access
    Studies on transmission, host range and management of ash gourd mosaic disease.
    (Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Divya, M; KAU; Vimi, Louis
    The present investigation, “Studies on transmission, host range and management of ash gourd mosaic disease” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-2011 with an aim to study the symptomatology of the mosaic disease, mode of transmission, host range of the virus, the resistance of available genotypes to mosaic under net house conditions and to evolve a suitable management practice under field conditions. The sampling survey for the collection of mosaic samples conducted in different locations of Thrissur district revealed the incidence of five types of mosaic symptoms viz., marginal yellowing, yellow-green patch, severe puckering, filiform type and light and dark green patch type on ash gourd leaves. The marginal yellowing was found to be the prominent type of symptom compared to the other four types of mosaic. Under natural condition, yellowing of leaf margin was the major symptom of marginal yellowing type mosaic. But under artificial condition, yellowing of veins and veinlets of the leaf starting from the margin was the prominent symptom. In sap transmission studies, citrate phosphate buffer (0.1 M, pH 7) gave maximum disease incidence (73 per cent) with 23-28 days of incubation. In vector transmission studies, Aphis gossypii gave 59.5 per cent disease incidence and Bemisia tabaci, was unable to transmit the virus. Biological indexing was done on Petunia hybrida and Vigna unguiculata to identify different viruses infecting ash gourd. Dark necrotic spot was produced in P. hybrida on inoculation with yellow-green patch type and severe puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Chlorotic spots were produced in V. unguiculata on inoculation with yellow-green patch type and puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Symptoms were not produced on inoculation with marginal yellowing type in P. hybrida and V. unguiculata. Based on the symptoms produced on V. unguiculata, it was ascertained that the virus causing yellow-green patch type mosaic belong to Cucumber mosaic virus group and the virus causing filiform type of mosaic belong to potyvirus group. The electron microscopic study of the marginal yellowing type and puckering type revealed that they also belong to potyvirus group. Host range studies of the ash gourd mosaic revealed systemic infection in snake gourd, bottle gourd, ivy gourd, tomato, chilli and cluster bean. Screening of 15 ash gourd genotypes against mosaic disease, revealed that one genotype, Jeevas was resistant to the mosaic with no disease incidence and one genotype BH-205 was moderately resistant (10 per cent incidence). The genotypes BH-206, BH-210, Indu, BHF-2, BHF-3, BHF-4, BHF-6, BHF-7, BHF-8 and BHF-9 were moderately susceptible (20-50 per cent incidence) and BH-216, BH-219 and BHF-5 were susceptible (70 per cent incidence) to mosaic. Field experiment conducted to evaluate the effect of botanicals, biocontrol agent and chemicals on ash gourd mosaic revealed that all treatments reduced disease incidence, severity and coefficient of infection and increased yield and among them quinalphos (0.05%) was the best. From the above study, it was concluded that marginal yellowing, yellow-green patch, puckering and filiformy were the major types of ash gourd mosaic and among them, mosaic with marginal yellowing symptom was the prominent one. The ash gourd mosaic was transmissible through sap and aphid. The virus causing marginal yellowing type mosaic belonged to potyvirus group. Snake gourd, bottle gourd, coccinia, tomato, chilli and cluster bean were found to be collateral hosts of the virus. Jeevas, a local genotype was identified as a resistant variety to ash gourd mosaic. The results of field experiment revealed that quinalphos (0.05 per cent) showed maximum effect in reducing mosaic infection.
  • ThesisItemOpen Access
    Bioefficacy of endophytic actinomycetes on plant growth promotion and management of bacterial wilt in tomato.
    (Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Sreeja, S J; KAU; Surendra Gopal, K
    The present study on ‘‘Bioefficacy of endophytic actinomycetes on plant growth promotion and management of bacterial wilt in tomato” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-11.The main objectives were to isolate endophytic actinomycetes from healthy tomato plants collected from five different locations, to study the antagonistic effect of those endophytic actinomycetes against bacterial wilt pathogen under in vitro conditions and their evaluation against bacterial wilt pathogen under pot culture experiment. Endophytic actinomycetes were isolated from tomato plants in Vellanikkara, Cherumkuzhy, Elanad (Thrissur district), Ozhalapathy and Eruthenpathy (Palakkad district). Only a single type of isolate was obtained from the different locations. The population was maximum in the roots of sample collected from Cherumkuzhy (EACK) (8x101 cfu/g) followed by Eruthenpathy (EAET) (3x101 cfu/g). The least count of endophytic actinomycetes was obtained from Vellanikkara (EAVK), Elanad (EAEN) and Ozhalapathy (EAOP) (1 x101 cfu/g). The pathogen causing bacterial wilt in tomato was circular, smooth, convex, slimy, fluidal, creamy white colonies with light pink centre indicating its identity as Ralstonia solanacearum. The efficacy of endophytic actinomycetes against R.solanacearum was evaluated under in vitro conditions. Out of the five isolates, maximum inhibition of the pathogen was observed with the Vellanikkara isolate (EAVK) (29.25%) which was on par with Ozhalapathy isolate (EAOP) (22.59%). The efficacy of culture filtrate of endophytic actinomycetes against R.solanacearum was also evaluated under in vitro conditions. Among the isolates, maximum inhibition of the pathogen was recorded with the Cherumkuzhy isolate (EACK) (44.63%) which was on par with Ozhalapathy isolate (EAOP) (42.59%). Based on the dual culture method and the effect of culture filtrate of antagonists, EAOP was found to be the best isolate under in vitro conditions. The morphological and cultural characters of endophytic actinomycetes were studied based on standard keys and the isolates were tentatively identified as Streptomyces. Among the isolates, EAOP produced the maximum concentration of IAA (73.1 µg/ml) followed by EACK (41.8 µg/ml) and the least was produced by EAVK (3.2 µg/ml). The mechanism of action of endophytic actinomycetes was studied based on the production of siderophores, HCN, ammonia and non-volatile metabolites by the isolates. The siderophore production was maximum in EAOP isolate followed by EAVK isolate and the least was produced by EACK isolate. None of the isolates were able to produce hydrogen cyanide. Maximum ammonia production was shown by EAVK, EACK and EAET isolates. All the isolates were able to produce non- volatile metabolites. Evaluation of endophytic actinomycetes against bacterial wilt pathogen was carried out under pot culture conditions. Minimum per cent wilt incidence was shown by plants in pots treated with urea (44 g m-2) and lime (500 g m-2) (T6) (29.63%) and it differed significantly from the other treatments. Among the endophytes, the plants treated with EAOP (T4) isolate showed minimum per cent wilt incidence (37.03%). The minimum per cent wilt index was also recorded with urea and lime (25.9%), followed by EAOP isolate (36.3%). Among the endophytic actinomycetes, EAOP was the most promising isolate for the management of bacterial wilt in disease. The efficiency of endophytic actinomycetes in plant growth promotion was assessed under pot culture experiment. The plant height was maximum in plants treated with EA OP isolate (77.31 cm). The plants treated with EAEN isolate took the minimum number of days for flowering (34.83 DAP) where as the plants treated with EAVK isolate took the minimum number of days to first harvest (81.66 DAP). Plants treated with EAET isolate produced the maximum number of fruits per plant (17.57) and the plants treated with EAOP isolate produced fruits with maximum weight (20.30 g). Highest yield was recorded for the plants treated with EAET isolate (332.02 g/plant) and the lowest yield was for the control plants. It was observed from the study that EAOP and EAET were the promising isolates in plant growth promotion. The five isolates were identified by National Center for Fungal Taxonomy (NCFT), New Delhi, based on their morphological and cultural characters as Streptomyces glaucescens (EAVK), Streptomyces griseoruber (EACK), Streptomyces griseous (EAEN), Streptomyces thermodiastaticus (EAOP) and Streptomyces griseolus (EAET). The identity of three efficient isolates (EAOP, EAET and EACK) obtained under pot culture experiment were further confirmed by 16S rRNA sequence analysis using PCR. The present studies indicated that the Ozhalapathy isolate (EAOP) (Streptomyces thermodiastaticus) was the most efficient among the five isolates of endophytic actinomycetes in plant growth promotion as well as in the management of bacterial wilt in tomato.
  • ThesisItemOpen Access
    Exploitation of spent mushroom substrate as mulch for the management of rhizome rot complex disease of ginger
    (Department of Plant Pathology, College of Horticulture, Vellanikkara, 2012) Remya, J S; KAU; Sheela Paul, T
    Spent mushroom substrate (SMS) is the composted organic material remained after the harvest of a crop of mushroom and it is rich in plant nutrients including minerals and was used as manure in different crops including ginger. Recent findings illustrate that substrate after one cycle cultivation of mushroom can be used for disease management. So far no attempt has been made on the use of spent mushroom substrate from oyster mushroom, against rhizome rot complex disease of ginger. Under these circumstances, a study was conducted to know the effectiveness of oyster mushroom SMS to control the rhizome rot complex disease of ginger. Bacterial wilt and soft rot are the two common rhizome rot diseases of ginger. Ginger plants showing typical wilt symptoms and soft rot symptoms were collected from the farmer’s field. The fungal pathogen Pythium aphanidermatum and the bacterial pathogen, Ralstonia solanacearum were isolated from the rhizomes showing typical symptoms, and pure cultures were maintained. Since Pleurotus florida and P. sajor-caju are the most suitable mushroom species in Kerala, they were selected for the production of spent mushroom substrate. The substrate used were agricultural waste materials like paddy straw, saw dust and neopeat. The enumeration of microorganisms at different stages of mushroom growth were made and the fungi commonly observed were Aspergillus sp. (FA-2 and FA-3) and Trichoderma sp. (FA-1). Maximum number of microbial population was noticed in paddy straw, whereas it was minimum in neopeat. From four different stages of mushroom growth, five different types of bacteria, BA-1, BA-2, BA-3, BA-4 and BA-5 were observed. An in vitro evaluation study was conducted to find out the efficiency of isolated organisms against the pathogens P. aphanidermatum and R. solanacearum. Among the bacterial isolates tested against P. aphanidermatum, BA-4 and BA-5 were effective, whereas against R. solanacearum, only BA-5 was found effective. All the three fungal isolates, FA-1, FA-2 and FA-3 gave 100 per cent inhibition against both the pathogens. But FA-1 was the most effective one. These five antagonists were selected for the compatibility studies by dual culture technique. The selected fungal antagonist FA-1 was identified as Trichoderma viride by studying cultural and morphological characters. The bacterial isolates BA-4 and BA-5 were identified as Pseudomonas aeruginosa and Klebsiella pneumoniae respectively. The effect of spent mushroom substrate for the management of rhizome rot complex disease of ginger was assessed under pot culture conditions. Two separate experiments were conducted for the management of P. aphanidermatum and R. solanacearum. All the treatments were applied at three times- at the time of planting, 60 DAP and 120 DAP. Among the various treatments for the management of both the pathogens associated with rhizome rot complex disease, T. viride from SMS and paddy straw SMS of P. sajor-caju as mulch were found to be the best giving cent per cent disease control. In control treatment, cent per cent disease incidence was noticed. In the experiment for the management of P. aphanidermatum, hundred per cent germination was noticed in the treatment, T. viride from SMS + Reference culture T. viride. Among the treatments with SMS as mulch, paddy straw SMS of P. sajor-caju showed better germination percentage. But in the experiment for the management of R. solanacearum, the treatment Klebsiella pneumoniae showed 100 per cent germination followed by the treatment T. viride from SMS. The growth parameters like number of tillers, number of leaves per tiller and height of tillers were highest in the treatment T. viride from SMS, at two, three, four and five months of planting, in the experiment for the management of P. aphanidermatum. But in the experiment for the management of R. solanacearum, the treatment paddy straw SMS of P. sajor-caju as mulch showed highest number of tillers. Number of leaves per tiller was highest in the treatment K. pneumoniae + reference culture P. fluorescens, in the first three months and the treatment with paddy straw SMS of P. sajor-caju as mulch for the next two months. Height of tillers was observed maximum in the treatments applied with T. viride from SMS. The same trend was noticed in the case of yield also. In the experiment for the management of P. aphanidermatum, highest yield was observed in the treatment T. viride from SMS. But in the experiment for the management of R. solanacearum, the treatment paddy straw SMS of P. sajor-caju as mulch produced highest yield. SMS is rich in microflora with antagonistic effect against pathogenic microorganisms associated with ginger plants. From the pot culture experiment it was clear that for the management of R. solanacearum and plant growth promotion, best treatment is paddy straw SMS of P. sajor-caju as mulch. High cellulolytic capacity of P. sajor-caju favour the maximum degradation of the substrate, thereby provides a niche for the multiplication of favourable microorganisms with antagonistic effect. Whereas, best treatment for the management of P. aphanidermatum and plant growth enhancement is T. viride from SMS. It was found to be better than reference culture T. viride. In addition the beneficial microorganisms may be having plant growth promoting activity which contributes to increased yield in the various treatments. So from the present study, it can be concluded that the use of paddy straw SMS of P. sajor-caju as mulch, along with the application of T. viride from SMS can be considered as an effective management practice against the rhizome rot complex disease of ginger. Depending on the location and climatic condition in which the mushroom crop is raised, the microorganisms harbouring in SMS will vary and they can be used for disease management in various crops.
  • ThesisItemOpen Access
    Ecofriendly management for fruit rot of chilli (Capsicum Annuum L.) caused by colletotrichum spp.
    (Department of Plant Pathology, College of Agriculture, Vellayani, 2010) Golda, S B; KAU; Mary, C A
    Chilli belonging to the family Solanaceae having Mexican centre of origin is an important spice cum vegetable crop grown for its pungent fruits. Besides being a rich source of spicy flavour and colour, they are free of cholesterol, low in sodium, rich in vitamin A, C, E, folic acid and potassium. India is a major producer, exporter and consumer of chilli. The area and production of chilli in the country is 7.57 lakh ha and 11.67 lakh tonnes. In Kerala, the area under cultivation is 14,000 ha with a productivity of 1000 Kg/ha. Chilli anthracnose / fruit rot was first reported in India by Sydow in the year 1913 from Coimbatore of erst while Madras Presidency. Anthracnose occurs both as pre harvest and post harvest decay of mature fruits and account for more than 50 % of the crop losses. Since 1940, chemical fungicides were used for the control of chilli diseases. The indiscriminate usage of a wide range of fungicides has invited many undesirable problems such as development of fungal resistance, toxic residues in the produce, environmental pollution and escalating costs in vegetable production. So there is an urgent need to find out an effective, alternative methods of disease control, which was less harmful to human beings and environment. The objective of the present investigation was to evolve an ecofriendly management strategy to control fruit rot of chilli using biocontrol agents, plant extracts and plant products. The study involves symptomatology of the disease under natural and artificial conditions. In both the situations, symptoms appeared as small brown sunken circular necrotic lesions with concentric rings of acervuli. The lesions enlarged elliptically and the fruit get shrivelled. During the present investigation, two species of Colletotrichum viz., C. gloeosporioides and C. capsici were isolated and the pathogenicity of the disease was proved. Conidial, morphological and cultural characters of both the organisms were studied. Conidia of C. gloeosporioides were cylindrical, straight with obtuse ends whereas that of C. capsici were falcate. Growth in different solid and liquid media, carbon sources, nitrogen sources, temperature and pH were studied. Best solid medium for the growth of C. gloeosporioides was Richards’ Agar whereas the best liquid medium was Richards’ broth, best carbon source - sucrose, best nitrogen source - Asparagine, best inorganic source - Potassium nitrate, optimum temperature 30˚С and optimum pH 6.0. Fungal antagonists obtained from the chilli phyllosphere were Penicillium sp., Aspergillus niger and from the rhizosphere Trichoderma harzianum, Gliocladium virens, Aspergillus flavus. Bacterial antagonists obtained from the rhizosphere was Bacillus sp. and Pseudomonas fluorescens. The best antagonist obtained under in vitro screening by dual culture technique T. harzianum, was selected for the in vivo study. Talc based formulation of T. harzianum was made and its shelf life was found to be more than 180 days. Leaf extracts at 60, 80 and 100 % concentrations from Piper betle, Ocimum sanctum, Azadirachta indica, Lantana camara, Datura stramonium, Andrographis paniculata and Bougainvillea glabra were tested against C. gloeosporioides under in vitro conditions by poisoned food technique and maximum inhibition of the pathogen was obtained in Datura stramonium at 80 and 100 % concentration. Lower concentrations of Datura stramonium were also tested (40, 20, 10 and 5 %) and it was found that as the concentration decreases, its effect is also found decreasing. Among the plant products viz., Turmeric powder, Garlic bulb extract, Neem Seed Kernel Extract and Neem oil tested against the pathogen, highest inhibition was obtained from Garlic bulb extract at 10 % concentration. Combinations of the biocontrol agent, plant extract and plant product were tested against the pathogen and it was observed that T. harzianum (1 %) + Datura stramonium (20 %) + Garlic bulb extract (10 %) completely inhibited the growth of C. gloeosporioides. Five chilli varieties released from KAU were screened against the disease and found that none of the varieties were found immune to the disease and the variety Vellayani Athulya was found to be the most susceptible one. This variety was selected for the in vivo management trial. For in vivo management of fruit rot of chilli a pot culture experiment in CRD with four replications and nine treatments was laid out at College of Agriculture, Vellayani. The treatments used were T. harzianum (1 %), Datura stramonium (20 %), Garlic bulb extract (10 %) individually and in combinations with standard fungicidal check Bavistin @ 0.05 % and unsprayed control. The variety Vellayani Athulya was used for the in vivo experiment. Among the treatments seedling dip with talc based formulation of T. harzianum 500 g per 1000 ml of water for 20 min. and two foliar sprays at five days interval with a combination of talc based formulation of T. harzianum @ 1 % + Datura stramonium leaf extract @ 20 % + Garlic bulb extract @ 10 % was found best for the management of fruit rot of chilli caused by C. gloeosporioides.
  • ThesisItemOpen Access
    Cataloguing and management of major diseases of monopodial orchids
    (Department of Plant Pathology, College of Horticulture,Vellanikkara, 2012) Meera, T M; KAU; Vimi, Louis
    Disease is one of the major production constraints in orchid cultivation. Hence an investigation has been undertaken to study the symptomatology, etiology and management of various diseases of important monopododial orchids viz., Phalaenopsis, Vanda (Basket Vanda), Mokara and Arachnis. A survey was conducted in different locations of Thrissur District viz., orchidarium of AICRP on Floriculture Improvement, Department of Pomolgy and Floriculture, COH, Vellanikkara, nurseries at Cheroor, Thrissur, Perinjanam, Madakkathara and Kanimangalam. Different fungal and bacterial diseases were observed and isolation of pathogen yielded eleven fungal pathogens and two bacterial pathogens. The pathogenicity of these organisms was proved by artificial inoculation.Symptomatology of various diseases was studied in detail under natural and artificial conditions. Fusarium sp. caused wilt symptom in Phalaenopsis and caused leaf spot in Arachnis. Sclerotium sp. caused collar rot in Phalaenopsis and dry rotting in Basket Vanda, Anthracnose pathogen, Colletotrichum sp. produced different symptoms in Phalaenopsis, Mokara and Arachnis. In Phalaenopsis, the symptom was irregular sunken spot, in Mokara leaf blighting and in Arachnis, round sunken spot. Heart rot was the symptom of Phytophthora infection in Basket Vanda. Botryodiplodia leaf spot of Basket Vanda was characterized by greyish white coloured spot with black margin and pycnidia at the centre. Alternaria leaf spot of Mokara, was round to oval shaped with a vertical splitting through the centre of the spot. Soft rot of Phalaenopsis by Erwinia sp. and bacterial wilt of Basket Vanda by Burkholderia sp. were the bacterial diseases observed during the survey. Water soaking and rotting of leaves were the symptoms of soft rot while yellowing, wilting and leaf detachment were the symptoms of bacterial wilt.Cultural characters and morphological characters of fungal pathogens were studied and they were identified at species level. Cultural, morphological and gram reaction of bacterial pathogens were studied and they were identified at species level by molecular techniques.For the management of fungal pathogens, an in vitro evaluation was conducted with fungicides and liquid formulation of Pseudomonas fluorescens. Most of the fungicides revealed cent per cent inhibition on the growth where as P. fluorescens showed 53 - 86 per cent inhibition. For the management of bacterial pathogens, an in vitro evaluation was conducted with cowdung, liquid formulation of P. fluorescens, cowdung + P. fluorescens and Streptocycline and differences were observed in their inhibitory properties. Seasonal influence on the incidence of diseases of monopodial orchids was studied for one year. Influence of temperature, humidity and rainfall was prominent in the incidence of Fusarium wilt, collar rot and soft rot of Phalaenopsis whereas not very prominent in the incidence and severity of Botryodiplodia, Alternaria and Fusarium leaf spot diseases of Basket Vanda, Mokara and Arachnis respectively . Incidence of Fusarium wilt was more in the month of November, collar rot in the month of December whereas bacterial soft rot was prominent in rainy months.
  • ThesisItemOpen Access
    Serodiagnosis and standardization of techniques for production of virus free planting materials of Cassava variety,Vellayani Hraswa
    (College of Agriculture, Vellayani, 2012) Asha, B Nair; KAU; Umamaheswaran, K
    Cassava (Manihot esculenta Crantz), the staple or subsidiary food for about one fifth of the world’s population, is an important source of dietary calories. Among the diseases and pests of cassava, cassava mosaic disease (CMD) is a serious factor limiting the productivity of cassava and the variety, Vellayani Hraswa is found to be highly susceptible to the disease. CMD is caused by viruses belonging to the genus Begomovirus of the family Geminiviridae. Since the crop is vegetatively propagated, the CMD is carried from one crop cycle to the next, through the use of infected cuttings used as planting material. Studies were conducted for the diagnosis of cassava mosaic geminivirus and production of disease free planting material of cassava variety, Vellayani Hraswa causing the mosaic disease of cassava in Kerala. The characteristic symptoms observed include chlorotic areas on the leaf and bright mosaic pattern of yellow or pale green patches. In severely affected plants, leaf distortion and twisting, reduction in size of leaf lamina and stunting of plant growth were observed. Host range studies were conducted and the virus was found to infect only Datura stramonium belonging to the Solanaceae family. The sap transmission of the virus using 0.1 M sodium phosphate buffer (pH 7.0) was found not successful from cassava to cassava. Chlorotic lesions were produced on the local lesion host, Datura which later turned necrotic. Insect transmission studies revealed that only whiteflies (Bemisia tabaci) were able to transmit the virus whereas the spiralling whiteflies (Aleurodicus dispersus) and mealy bugs (Ferrisia virgata) associated with cassava could not transmit the virus. Graft transmission of the virus was also found successful. The pathophysiological studies revealed that the total carbohydrate and phenol contents in graft inoculated plants were significantly higher compared to the uninoculated cassava plants. The content of chlorophyll a, b and total chlorophyll were lower in inoculated cassava plants. There was a decrease in total protein content in inoculated plants compared to the healthy plants but was found to be increasing at different stages of inoculation. The activity of the defense related enzymes were higher in case of inoculated plants than that of the control plants. Protein profile study of virus infected cassava plants using SDS- PAGE showed an extra novel protein with approximate molecular weight of 40 KDa corresponding to the coat protein of the virus. Isozyme analysis of polyphenol oxidase produced three isoforms in both healthy and inoculated plants with relative mobility (Rm) values of 0.68, 0.75 and 1. Two isoforms with Rm values 0.63 and 0.74 were observed in case of peroxidase isozyme analysis in inoculated plants whereas only one in healthy plants. The activities of the isoforms were more in the inoculated plants. Serological and molecular characterization of the virus was also done. The virus was partially purified from the infected leaves and antiserum with a titre of 1: 512 was produced. Serological characterization of the virus using ELISA showed the close relationship of ACMV and ICMV with the disease. Presence of the virus in the whitefly vector B. tabaci was confirmed through DAC- ELISA. Detection of the virus was also done using Dot Immunobinding Assay (DIBA). A field level diagnostic kit using DIBA was developed. Multiplex PCR using ICMV and SLCMV specific primers produced an amplicon of size 600 bp corresponding to the DNA- A fragment of SLCMV. Sequencing of the PCR product obtained 584 bp long nucleotide sequences. The cluster dendrogram constructed by multiple alignment of sequences showed three major clusters and the isolated viral sequence shared the same cluster with SLCMV isolates collected from Kerala. The meristem from the infected cassava plants were regenerated into complete plantlets within 30 days in a suitable MS media supplemented with benzyladenine (0.5 ml l-1), naphthalene acetic acid (0.1 ml l-1) and gibberellic acid (0.1 ml l-1) of millimolar concentration. Root induction was better in the basal MS media and was tested for the presence of the virus by subjecting it to DAC- ELISA. The absorbance of the plantlet regenerated from healthy and infected meristem were found to be 0.22 and 0.31 respectively which was on par with the healthy field sample (0.28) but much lower than that of the infected field sample (1.23) which was used as the positive control. The virus free plantlets were transferred to pots containing sand, soil and compost in 1:1:1 ratio and were grown in a green house. Meristem culture and virus indexing by use of protein and nucleic acid based detection thus, can be used as a viable strategy for the early detection and elimination of the virus and hence for the production of virus free planting materials.