Thumbnail Image

Theses

Browse

2018 - 20192
Reset filters
Subject: Nematology × Author: KAU × End date: 2019 × Start date: 2010 × Type: Thesis × Thesis Type: M.Sc ×
Reset filters

Search Results

Now showing 1 - 2 of 2
  • Thumbnail Image
    ThesisItemOpen Access
    Pathogenicity of indigenous entomopathogenic nematodes against select insect pests
    (Department of Nematology, College of Agriculture, Vellayani, 2019) Sooraj, S; KAU; Nisha, M
    An investigation entitled “Pathogenicity of indigenous entomopathogenic nematodes against select insect pests” was carried out at the Department of Nematology, College of Agriculture, Vellayani during 2017-19. The main objectives were to identify indigenous entomopathogenic nematodes and evaluate their pathogenicity to termites, lepidopteran and coleopteran pests. Survey was conducted in Thiruvanathapuram, Kollam, Pathanamthitta and Alappuzha districts during 2017-18 and a total of forty soil samples were collected from the rhizosphere of vegetables, banana and coconut by random sampling. Entomopathogenic nematodes (EPN) were isolated from soil using Corcyra cephalonica larvae by insect trap method. EPN from insect cadavers were extracted by white trap method. From forty soil samples collected, three species of EPN were isolated and their morphological characters were studied. The infectivity of native EPN strains were assessed at an inoculum level of 300 IJs/insect against test insects viz. termites, aphids, tobacco caterpillar and pseudostem weevil under in vitro condition. Among the isolates, isolate obtained from Mylom area in Kottarakkara (Isolate 2) showed maximum emergence of Infective Juveniles (IJs) from termites (2.0x103 IJs/adult), aphids (1.2x103 IJs/adult), tobacco caterpillar (3.5x105 IJs/larvae) and pseudostem weevil (3.5x105 IJs/grub). Isolate 2 also showed mortality percentage of 87.99, 86.00, 29.99 and 9.99 against termite, aphids, tobacco caterpillar and pseudostem weevil respectively at 24 hours after treatment. Isolate obtained from College of Agriculture, Vellayani (Isolate 1) and Isolate obtained from Kainidi area in Alappuzha (Isolate 3) showed mortality of 86.00 and 76.00 per cent in termites and 81.74 and 71.99 per cent in aphids respectively. Infection of Isolate 2 resulted in brown, pink and reddish brown discolouration in cadavers of termites, tobacco caterpillar and pseudostem weevil respectively. Based on results of preliminary screening, Isolate 1, 2 and 3 were tested for their pathogenicity against test insects under in vitro condition. The experimental design used was CRD with treatments viz., 10, 50, 100, 200 IJs, sterile water and chemical check and were replicated four times. Isolate 1 and 2 @ 100 IJs caused cent per cent mortality of termites at 48 hours after treatment (HAT) and it was statistically on par with chlorpyriphos 25 EC. Isolate 3 @ 200 IJs showed cent percent mortality of termites at 60 HAT. Isolate 2 @ 200IJs recorded 99.26 per cent mortality of aphids at 36 HAT and it was statistically on par with chemical, dimethoate 30 EC. Isolate 2 @ 100 IJs recorded cent percent mortality of aphids at 48 HAT. In the case of tobacco caterpillar, Isolate 2 @ 200 IJs recorded 65.08 and 80.52 per cent mortality at 48 and 60 HAT respectively. Isolate 2 @ 100 IJs recorded 92.53 per cent mortality of tobacco caterpillar at 72 HAT and it was statistically on par with chemical, flubendiamide 39.35 EC. Isolate 2 @ 200 IJs showed 62.66 per cent mortality of pseudostem weevil grubs at 72 HAT. Among the three isolates, Isolate 2 is proved to be the most potent EPN strain with highest mortality in termites, aphids, tobacco caterpillar and pseudostem weevil. Based on the morphological characters, Isolate 1 was identified as Steinernema sp., Isolates 2 as Metarhabditis sp. and Isolate 3 as Rhabditis sp. The IJs of Steinernema sp. were specific in retaining the second stage cuticle. The adults were characterized by short stoma, excretory pore anterior to the nerve ring and a muscular oesophagous (female-154.00±5.57µm, male-144.40±4.14µm) without a well-defined butterfly valve in the basal bulb. The males had a C shaped body having pointed and curved spicules (44.10±4.46µm) with a boat shaped gubernaculum (23.70±2.98µm). The females had a sub median protruding vulva. The IJs of Rhabditis sp. had a narrow body without second stage cuticle. The adults of Rhabditis sp. had six unfused labium at the anterior region, long tubular stoma, excretory pore anterior to the basal bulb and a muscular oesophagous with a well-defined butterfly valve. Metarhabditis sp. (Isolate 2) had lobed oesophageal glands different from Rhabditis sp. (Isolate 3). The males of Metarhabditis sp. (Isolate 2) had a round manubrium in spicules (39.63±3.59µm) unlike males of Rhabditis sp. (Isolate 3) (33.83±4.36µm). Metarhabditis sp. (Isolate 2) was characterized by presence of peloderan bursa with eight papillae whereas Rhabditis sp. (Isolate 3) had leptoderan bursa with nine papillae. The male tail in Metarhabditis sp. (Isolate 2) (28.60±5.10µm) was straight and pointed whereas Rhabditis sp. (Isolate 3) had a ventrally curved tail (29.71±4.86µm). Vulva was characterized by slightly protruding vulval lips in females of Rhabditis sp. Based on the pathogenicity studies, Isolate 2 (Metarhabditis sp.) was identified as the most potent strain causing highest mortality in test insects. Hence molecular characterization of Isolate 2 was done and result revealed it as Metarhabditis rainai. This was the first report of M. rainai in India. From the above study it could be concluded that M. rainai can be exploited as a successful biocontrol agent pertaining to its pathogenicity against termites, lepidopteran and coleopteran pests and effort needs to be directed towards formulating the strain to improve its efficiency and shelf life.
  • Thumbnail Image
    ThesisItemOpen Access
    Exploitation of indigenous bacterial antagonists against root-knot nematode, meloidogyne incognita (kofoid and white ) chitwood
    (Department of Nematology, College off Agriculture, Vellayani, 2018) Vishnu, J S; KAU; Nisha, M S
    An investigation entitled "Exploitation of indigenouos bacterial antagonists against root-knot nematode, Meloidogyne incognita (Kofoid and White)Chitwood" was carried out at department of nematology, college of agriculture, vellayani during 2016-2018. The objective was to isolate indigenous bacterial antagonists and to evaluate their bio control potential against root-knot nematode. A survey was conducted in three agro ecological units viz., high ranges in Idukki, midlands in Thrissur and low lands in Thiruvananthapuram districts during 2016-17 for isolation of indigenous bacteria. A total of sixty two soil and fifty eight root samples were collected from the rhizosphere of cardamon, pepper,rice and vegetables by randon sampling. Thirty eight bacterial colonies showing characteristics similar to Bacillus and Pseudomonas were selected and brought into pure culture by streak plate technique. Twelve isolates which showed 66.00 to 94.00 percent mortality of M. icognita juiveniles were selected after preliminary screening under in vitro condidtions. Morphological and cultural characteristics and colony forming units of twelve isolates were studied.. Bio efficacy study of twelve isolates on M. incognita juveniles revealed that four isaolates at lowest concentration (25%) showed 58.00 to 72.50 percent mortality of M. incognita juveniles 72 hr after exposure. Isolate 1,2,3 and 4 showed 91.00, 94.00,87.00 and 81.50 percent mortality of M. incognira juveniles at 100 percent concentration, 72 hr after treatment respectively. Cell free extracts of these four isolates were screened for ovicidal and larvicidal effects against M. incognita under in vitro. Sterile water and plain broth were maintained as control. Results of the in vitro screening studies revealed dthat cell free extract of isolate 1 amd 2 (100% concentration ) were effective in inhibiting the egg hatching at three to eight days after treatment (0.20 to 7.96 percent). These two isolates at (100% concentration ) also showed statistically significant superiority over all other isolates allowing only 4.65 to 7.96 per cent egg hatching compared to control on 6th, 7th and 8th day after treatment. Isolate 2 at 100% concentration was effective in increasing the mortality of M. incognita juveniles at 24, 48 and 72 hr after treatment (27.00 to 94.00 percent). Isolate 1 and Isoslate 2 (100% concentration) were found to be statistically on par in exhibiting 51.50 and 54.00 per cent juvenile mortality respectively after 48 hr of treatment. Based on larvicidal and ovicidal properties of cell free extracts, two isolates were selected for pot culture experiment to find out the efficacy in comparison with NBAIR isolate (Bacillus subtilis), organic amendment (neem cake) and chemical cartap hydrochloride). The results revealed that soil drenching with isolate 2 (1*10 7 cfu mL-1)@ 50 mL pot-1 was effective in reducing the nemotode population in soil (72.69 per cent) and root(82.33 per cent ) and it was significantly superior to B.subtilis, Isolate 1 and neem cake. Efficacy of Isolate 2 was found to be statistically on par with chemical, cartap hydrochloride in reducing the number of galls (73.92 to 75.64 percent and females (60.00 to 68.57 per cent ) in root. Isolate 2 was significantly superior to all other treatments in improving the growth parameters (fresh plant weight and root weight). Significantly superior yield was also recordede by isolate 1 and 2 in comparison with neem cake and B.subtilis. Biochemical and molecular characterization were done for identification of bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of Isolate 1 and 2 were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. Blast search of amplified DNA in NCBI data revealed the identity of Isolate 1 and Isolte 2 as Bacillus thuringiensis strain a57 and stenotrophomonas maltophilia strain W2-7 respectivelly. The identity of bacteria was further confirmed by biochemical analysis. The present study was successful in identifying two bacterial antagonists (Stenotrophomonas maltophilia strain W2-7 and Bacillus thuringiensis strain a57) against root-knot nematode. Results revealed that these two isolates suppressed population of M.incognita and increased growth and yield in tomato plants. Soil drenching with these two indigenous bacterial isolates (1*10 7 cuf ml-1)@ 50 mL pot-1can be recommended to manage M.incognita in tomato without any detrimental effect on environment.