Skip navigation
Beta Version
TNV_35thVCRI_CA_Dec-2019_SRSO-20.pdf.jpg
Article

A total of 297 sheep were genotyped for polymorphism in the IGF-I gene in Mecheri and Madras Red sheep breeds. In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed th...

1
2
0
0
TNV_IJCMAS_2020_9(4)1482-1485.pdf.jpg
Article

An unrecognized breed of Molai goat is seen in some taluk of Erode district and certain parts of Namakkal and Salem Districts. A total of 20 milk samples were collected from different places of home tract of Molai goat breed. Composition and nutritive value of milk collected from Molai goat breed doe was studied. The Molai breed doe milk’s crude protein (%), fa...

1
4
0
0
TNV_SIJVS_2018_6(1)5-10.pdf.jpg
Article

Broiler farming in India is also one of the major profitable industries which can effectively tackle the problems of unemployment and under employment. The present study has identified and ranked the constraints in contract and non contract broiler farming in western and north western zones of Tamil Nadu. The data was collected from 40 contract and 40 non contract ...

1
3
0
0
TNV_IJLR_2019_9(7)143-147.pdf.jpg
Article

A study was undertaken in 203 Murrah and graded Murrah buffaloes reared under organised farm and farmers field conditions in Tamil Nadu and Andhra Pradesh to study the polymorphism of FSHR gene by PCR- RFLP method and to analyse the possible associations of these gene variants with age at first calving and calving intervals. The PCR amplification carried out with s...

1
2
0
0
TNV_IJSR_2019_25(2)234-235.pdf.jpg
Article
2019
Indian Society for Sheep and Goat Production and Utilization

Bone morphogenetic protein (BMP) genes are members of the transforming growth factor beta (TGF- ) super-family, which ! are multifunctional cytokines with a two-fold function and expressed in a variety of cells. BMPs were originally identified on the basis of their ability to produce ectopic bone formation when implanted within soft tissue in vivo. They also ...

1
1
0
0
TNV_Ijcmas_2018_7(1)2718-2721.pdf.jpg
Article

Estrogen hormone is an important hormone found to be linked with reproductive traits and affect the growth, differentiation and function of reproductive tissues. Estrogen receptor gene (ERα) is considered as candidate marker for fertility traits in farm animals. The present study was undertaken with 203 buffaloes from different locations. The Polymerase Chain ...

1
3
0
0
TNV_IJFV_2011_7(1)27-29.pdf.jpg
Article

The parasitic diseases in donkeys are responsible for enormous losses in the form of productivity, morbidity and mortality. A total of 24 donkeys were selected for the study. The samples were collected in summer (March-June), rainy (July-October), and winter (November-February) seasons. The present study revealed 33.33% - 58.83% strongylus ,4.17% - 37.50% ascari...

1
0
0
0
TNV_JEZS_2017_5(6)2011-2013.pdf.jpg
Article

The present study was undertaken with 204 buffaloes during June, 2016 to July, 2017 from different locations viz., Saraswathi Krishi Vigyan Kendra, Karur district, Tamil Nadu; Post Graduate Research Institute in Animal Sciences (TANUVAS), Katupakkam, Tamil Nadu; Central Cattle Breeding Farm, Alamadhi, Chennai, Tamil Nadu; Buffalo Research Station, Venkataramanna Gu...

1
3
0
0
172004.pdf.jpg
Thesis
2002
Department of Animal Breeding and Genetics, College of Veterinary and Animal Sciences, Mannuthy

Malabari goats are noted for their high milk yield and meat production qualities. They represent a unique genetic resource by virtue of their adaptability, resistance to many infectious diseases and prolificacy in the humid tropics of Kerala. They also exhibit considerable variation in individual performance in milk production, growth rate and fecundity. ...

1
3
0
0