Pundhir, V.S.Mohammad Ansar2017-05-302017-05-302012-08http://krishikosh.egranth.ac.in/handle/1/5810013223Potato, one of important and popular vegetable, is consumed throughout the year in all parts of India. The crop in Tarai region of Uttarakhand is adversely affected by several biotic factors. Stem necrosis disease is an emerging problem in this area, which has become a serious problem on the early planted crop in the central western parts of India. Disease incidence up to 90% was recorded in some parts of Madhya Pradesh and Rajasthan and yield losses due to the disease vary greatly 15-30% from place to place and year to year. Keeping in view of economic importance and potential threat of the new disease, the present investigation was undertaken to study the occurrence, molecular characterization of virus, disease development under different treatments, comparative assessment of disease at two locations (Kota and Pantnagar), effect of disease on different cultivars and germplasm screening. The causal agent of disease, a virus was confirmed by RT-PCR using specific primer pair, HRP26-5’ATGTCTAACGTYAAGCARCTG 3’/HRP28-5’ TTACAATTCCAGCGAAGGACC 3’ targeting NP gene of GBNV. Infected samples provide suitable templates for use in RT-PCR and a cDNA fragment of expected size (~800 bp) was observed, suggesting the association of GBNV with stem necrosis samples. At nucleotide and amino acid level, the present virus isolate GBNV-[Pot-USN] had more than 90 per cent identities with known GBNV isolates. This is the first authenticated report of GBNV, a Tospovirus, infection in Tarai region of Uttarakhand on potato. Sap inoculation on cowpea plants, Pusa Komal, produced characteristic symptoms. Thrips inoculated plant showed necrotic elongated spots on young stem in varying acquisition and inoculation assess periods. During cropping season 2010-11and 2011-12 the results revealed that more disease incidence (39.55 and 44%) was recorded in early planted crop and late planted crop showed less disease incidence (3.1 and 3.3%) in insecticide application plots. In general comparatively higher disease severity was recorded in third (22.15%) and fourth (25.15%) week of January 2011. Whereas it was between 23.40 and 30.23% in first and second week of January, 2012, respectively. In study of Kota and Pantnagar location, the incidence of disease was higher (59%) in the crop planted on 17th October at Kota, however at Pantnagar it was 36.67%. Effect of disease on six popular cutivars, maximum disease incidence (7.33 and 8.63%) recorded in Kufri Bahar at VRC in two cropping seasons, respectively, while in case of K. Jyoti under similar condition, the disease incidence were 1.40 and 1.43 in two season. Out of 60 potato germplasms screened under field conditions, 10 were found highly resistant, whereas 22 were resistant and 9 were moderately resistant. Nine germplasms were categorized as susceptible and 10 as highly susceptible.ennullThesis