Anitha Cherian, KDivya, C RKAU2020-11-042020-11-042011173087https://krishikosh.egranth.ac.in/handle/1/5810154312MScThe banana (Musa spp.) is a crop of global importance in terms of income security to million of small farmers throughout the developing countries. It is the world's fourth most important commodity after rice, wheat and corn and is produced in tropical and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria and viruses. Among the viral diseases, Banana streak is now emerging as a major disease affecting banana production world wide. This disease assumes significance as it affects plant growth, fruit yield and quality. It is also causing problems to germplasm exchange and in the certification of in vitro plantlets for international trade. The present project was undertaken to study the symptomatology of Banana streak disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of Banana streak virus, to standardize molecular indexing of planting materials of banana and to identify the source of resistance in the field gene bank. The symptoms of the disease appeared on different parts of the plant such as leaf lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later turned necrotic, blackened and running perpendicular to the leaf axis extending from midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina especially on older leaves. Dark brown coloured linear lesions appeared on other parts like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and death of cigar leaf was noticed. The plants showing such symptoms did not flower and resulted in 100 percent yield loss. The impact of the disease on biometric and yield characters was studied and observed that the disease affected the growth and yield of banana. A significant correlation was observed between the expression of symptoms with rainfall and temperature. The expression of the symptoms was more in cooler months and less in summer. The field gene bank comprising 290 accessions maintained at BRS, Kannara was screened to assess the reaction of these accessions to the disease. The disease incidence was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB), Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3 (AAAB). The percent disease incidence ranged from13.25 to 32.16 . The transmission studies proved that BSV was not transmitted mechanically or through infected soil. The insect vectors of BSV were proved to be two species of mealy bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The studies on virus vector relationship of these mealy bugs showed that the maximum acquisition feeding period, pre-acquisition fasting period, inoculation access period required for successful transmission were three days, one hours and seven hours respectively. The nymphs were more efficient vectors than adults. A minimum of thirty numbers were required for successful transmission of BSV. Plants inoculated with Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and in the case of Ferrisia virgata (Cockerell), it was six weeks. Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug has any role in the transmission of BSV. It was found that Geococcus sp. could not transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of Banana bunchy top disease had no role in the transmission of the virus. The studies on the transmission of the BSV through planting material proved that BSV is naturally transmitted through the planting materials of banana. PCR based molecular diagnosis is one of the reliable and quick method for the virus indexing of planting materials. The molecular diagnosis of BSV using polymerase chain reaction from infected samples was standardized using specific primers, (BSV 5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5' GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could be done directly from the crude sap, avoiding the step of DNA isolation. The outcome of this study will facilitate early detection and elimination of BSV infected plants and ensure distribution of healthy planting materials both suckers and tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well as the productivity of banana in the state.EnglishThesis