Faizal, M HLiz, J MampallilKAU2020-02-122020-02-122017http://krishikosh.egranth.ac.in/handle/1/5810142921PGThe study entitled “Management of major chewing pests, Henosepilachna septima (Dieke) and Diaphania indica (Saund) infesting bitter gourd with bacterial bioagents” was conducted during the period 2015-2017, in the Department of Agricultural Entomology at College of Agriculture, Vellayani. The objective was to manage the chewing pests using phylloplane and pathogenic bacteria. Thirteen bacteria were isolated from the phylloplane of bitter gourd by taking leaf impression on M-9 minimal agar media. Upon preliminary screening for pathogenicity, three isolates (isolate 1, 5 and 7) were found to be pathogenic to H. septima and four (isolate 3, 5, 7 and 12) to D. indica. Laboratory evaluation of pathogenic phylloplane isolates was done by oral exposure adopting leaf disc method, along with other entomopathogenic bacteria viz, Serratia marcescens (Hv3) obtained from H. vigintioctopunctata, Pseudomonas fluorescens (PN026R) and Bacillus thuringiensis var. kurstaki. Treatments with S. marcescens (Hv3) and isolate 5 were found to be significantly superior in causing mortality to H. septima grubs at 1, 3, 5 and 7 DAT. Mortality of 90 per cent and 83.33 per cent were observed for S. marcescens (Hv3) and isolate 5 respectively at 5 DAT. Leaf area damage was also found to be significantly low in treatments with S. marcescens (Hv3) and isolate 5 (7.93 per cent and 14.68 per cent respectively) than control (100 per cent) at 5 DAT. S. marcescens (Hv3) and isolate 5 were found to be effective against D. indica also, causing 96.67 per cent and 93.33 per cent mortality at 5 DAT, which was equally effective as chemical insecticide (Flubendiamide 39.35 SC, 0.004%) and commercial microbial pesticide, B. thuringiensis. Larvae treated with S. marcescens (Hv3) and isolate 5 caused leaf area damage of 2.71 per cent and 5.23 per cent only as against 77.75 per cent in control. Internal transcribed regions of DNA of 16S rRNA of isolate 5 and 7 were amplified using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer in PCR. Blast search of amplified DNA in NCBI data base revealed the identity of isolate 5 and 7 as Serratia marcescens and Klebsiella sp respectively with 99 per cent and 100 per cent homology. The identity of the bacteria were further confirmed by biochemical analysis in which isolate 5 exhibited negative reaction with respect to urease, malonate and raffinose characteristic to S. marcescens, and isolate 7 exhibited urease, melibiose and glucose positive reaction, characteristic to Klebsiellla sp. Chitinase activity of 1.24 and 1.07 units were recorded in S. marcescens (pmc5) and Klebsiellla sp respectively using chitin azure method, indicating the potential of these phylloplane bacteria in breaching the peritrophic membrane of chewing insects. A pot culture experiment was carried out to evaluate the efficacy of foliar application of selected bacteria @ 108 cfu ml-1 against chewing insects in bitter gourd. The phylloplane isolate S. marcescens (pmc5) produced significantly high mortality in both H. septima (65.83 per cent) and D. indica larvae (87.78 per cent) at 7 DAT, which was on par with chemical treatment quinolphos 0.05%. Treatments with S. marcescens (Hv3) obtained from H. vigintioctopunctata which produced high mortality of 42.06 per cent in H. septima and 49.01 per cent and 57.14 per cent in D. indica at 5 and 7 DAT was the next best treatment. At 5 DAT plants treated with S. marcescens (pmc5) showed significantly low population of H. septima grubs (6.46 grubs plant-1) and D. indica (2.08 larvae plant- 1 ) than control (17.23 grubs plant-1 and 17.68 larvae plant-1). Plants treated with S. marcescens (pmc5) showed 68.78 per cent and 71.91 per cent leaf area damage reduction over untreated control by H. septima and D. indica respectively at 5 DAT. S. marcescens (Hv3) treatment caused 61.30 per cent and 53.53 per cent reduction of leaf area damage by H. septima and D. indica respectively over untreated control at 5 DAT. Thus, S. marcescens (pmc5), isolated from phylloplane of bitter gourd is found effective against chewing pests of bitter gourd. Since the field use in live form of S. marcescens is limited due to its opportunistic animal pathogenic nature, investigations have to be undertaken on insect toxic secondary metabolites produced by it to yield biocontrol products.ennullThesis