Kerala Agricultural University, Thrissur

The history of agricultural education in Kerala can be traced back to the year 1896 when a scheme was evolved in the erstwhile Travancore State to train a few young men in scientific agriculture at the Demonstration Farm, Karamana, Thiruvananthapuram, presently, the Cropping Systems Research Centre under Kerala Agricultural University. Agriculture was introduced as an optional subject in the middle school classes in the State in 1922 when an Agricultural Middle School was started at Aluva, Ernakulam District. The popularity and usefulness of this school led to the starting of similar institutions at Kottarakkara and Konni in 1928 and 1931 respectively. Agriculture was later introduced as an optional subject for Intermediate Course in 1953. In 1955, the erstwhile Government of Travancore-Cochin started the Agricultural College and Research Institute at Vellayani, Thiruvananthapuram and the College of Veterinary and Animal Sciences at Mannuthy, Thrissur for imparting higher education in agricultural and veterinary sciences, respectively. These institutions were brought under the direct administrative control of the Department of Agriculture and the Department of Animal Husbandry, respectively. With the formation of Kerala State in 1956, these two colleges were affiliated to the University of Kerala. The post-graduate programmes leading to M.Sc. (Ag), M.V.Sc. and Ph.D. degrees were started in 1961, 1962 and 1965 respectively. On the recommendation of the Second National Education Commission (1964-66) headed by Dr. D.S. Kothari, the then Chairman of the University Grants Commission, one Agricultural University in each State was established. The State Agricultural Universities (SAUs) were established in India as an integral part of the National Agricultural Research System to give the much needed impetus to Agriculture Education and Research in the Country. As a result the Kerala Agricultural University (KAU) was established on 24th February 1971 by virtue of the Act 33 of 1971 and started functioning on 1st February 1972. The Kerala Agricultural University is the 15th in the series of the SAUs. In accordance with the provisions of KAU Act of 1971, the Agricultural College and Research Institute at Vellayani, and the College of Veterinary and Animal Sciences, Mannuthy, were brought under the Kerala Agricultural University. In addition, twenty one agricultural and animal husbandry research stations were also transferred to the KAU for taking up research and extension programmes on various crops, animals, birds, etc. During 2011, Kerala Agricultural University was trifurcated into Kerala Veterinary and Animal Sciences University (KVASU), Kerala University of Fisheries and Ocean Studies (KUFOS) and Kerala Agricultural University (KAU). Now the University has seven colleges (four Agriculture, one Agricultural Engineering, one Forestry, one Co-operation Banking & Management), six RARSs, seven KVKs, 15 Research Stations and 16 Research and Extension Units under the faculties of Agriculture, Agricultural Engineering and Forestry. In addition, one Academy on Climate Change Adaptation and one Institute of Agricultural Technology offering M.Sc. (Integrated) Climate Change Adaptation and Diploma in Agricultural Sciences respectively are also functioning in Kerala Agricultural University.

Browse

Search Results

Now showing 1 - 9 of 25

Open Access
Standardization of technique cultivation of Tricholoma giganteum Massee in Kerala
(Department of Plant Pathology, College of Agriculture,Vellayani, 2013) Prathibaha, P R; Lulu Das
The present investigation on “Standardization of techniques for cultivation of Tricholoma giganteum (Massee) in Kerala” was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani, during 2012-2013. The aim of the study was to explore the possibility of cultivation of Tricholoma giganteum (Massee) on readily available cheap substrates and to develop a package for commercial cultivation in Kerala. Mushrooms were collected from different parts of Trivandrum districts before and after the South West and North East monsoons. Preliminary trials laid out showed that isolate 1 was the best out of 4 isolates which was sent to DMR. This isolate with accession number DMRO- 462 was used for further studies. Tricholoma has a convex pileus, off white to creamy white in colour, fleshy in texture and with a stout hairy stipe. Cultural studies conducted showed that the isolate attained full growth in petridish in 14 days on oat meal agar and least growth was found in carrot agar medium. Out of six carbon sources dextrose was found to be best for the radial growth of Tricholoma, least growth was found in galactose. Among the seven nitrogen sources used to study the radial growth of Tricholoma in petridish beef extract was found to best and least in ammonium nitrate. Temperature of 35 ⁰C, fluorescent light conditions and pH8 were found to be the best for the growth of Tricholoma giganteum. Evaluation of six different spawn substrates showed that paddy grains was best spawn substrate since complete spawn run was attained in two weeks. Regarding yield studies beds laid out with wheat grain spawn gave highest yield of 833.33 g / bed. Saw dust took maximum time for spawn run and lowest yield was also recorded in it. Six different locally available cheap substrates viz., paddy straw, sugarcane bagasse, saw dust, coir pith compost, spent mushroom substrates and coir pith + paddy straw were used for the cultivation of Tricholoma giganteum. Highest yield (694.50 g) was found to be in beds prepared from paddy straw and lowest yield (199.50 g) was observed in beds laid out with coir pith + paddy straw as substrate. Out of the casing materials tried vermi compost was found to be the best. Lowest yield was found be in beds cased with red soil + sand. Analysis of nutrient composition of Tricholoma giganteum indicated that, the moisture content, protein, fat, carbohydrate, ash and fibre content was found to 87.46 %, 23.20 %, 2.60 %, 10.10 %, 11.46 % and 19.01 % respectively. The shelf life of fresh mushroom was high (7 days) when stored in polypropylene cover without perforation in refrigerated condition. For mushroom dried in hot air oven the shelf life was found to be 60 days. Pests like sciarid flies and staphylinid beetle were prevalent after the second harvest only. Coprinus, cob web (Cladobotryum dendroides) and Trichoderma causing decay of the fruiting body was observed in Tricholoma giganteum beds when temperature and relative humidity was high. Results of organoleptic studies revealed that Tricholoma has high cooking quality and overall consumer acceptability was good. Cutlets were found to be the best when consumed by the panel of judges followed by payasam. The overall acceptability of soup made out of dried mushroom powder was comparatively poor. Based on the results obtained during the investigation it can be concluded that Tricholoma is a new summer edible mushroom most suited for the Kerala conditions. The technology of cultivation of Tricholoma on paddy straw substrate using wheat or paddy spawn and vermi compost as casing material can be recommended as a suitable domestication package which will be transferred to the farmers along with the release of this mushroom variety.
Open Access
Characterization and management of ganoderma lucidum inciting basal stem rot of coconut
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2012) Yunus, C; KAU; Beena, S
The present study on “ Characterization and management of Ganoderma lucidum inciting basal stem rot of coconut ” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2010-2012 with an aim to isolate the pathogen associated with the disease and to study the cultural, morphological and pathogenic characters of different isolates of the pathogen, symptomatology of the disease, host range and effective management of the pathogen using bio-control agents, phytoextracts and selected fungicides. Purposive sampling surveys were conducted and the occurrence of basal stem rot disease of coconut was observed through out Kerala. The isolation of pathogen from basidiocarps yielded eight isolates of Ganoderma sp. which produced fruiting body in saw dust- rice bran substrate. The pathogenicity of these isolates was tested and observed yellowing, drying and drooping of leaves of coconut seedlings inoculated with all isolates except the isolate GT- from Trivandrum. Basidiocarp formation was noticed only in one seedling inoculated with the isolate GV from Vellayani and reisolation of pathogen was done from this basidiocarp. Symptomatology of the disease under natural and artificial conditions was studied. Under field condition the typical symptom of BSR disease viz., yellowing and drooping of leaves, stem bleeding and basidiocarp formaton were observed in all surveyed areas but all the typical symptoms of disease were not observed under artificial condition. The cultural characters of all the isolates of pathogen were studied on four media viz., Potato dextrose agar, Czapek’s (DOX) agar, Richard’s agar and Soil extract agar media. All isolates produced white mycelial growth on all media but variations in texture, mycelial type, and colour change of mycelium, exudates production and formation of aberrant fruiting body were observed. PDA was found to be the best medium for the growth of pathogen in which all isolates recorded highest growth rate. The pathogen preferred a temperature range of 30-350C and neutral to acid pH of 5-7 for the growth. Slight variation in growth rate was observed under light and darkness. Basidiocarps showed variations in the morphological characters and were stipitate in all isolates except GC from Chirakkacode and GVe from Vettikkal, semicircular to conical shaped, yellowish red to reddish brown with smooth to waved margin, creamy white to brown pore surface, 4.4 – 12.0 x 2.6- 17.0 cm size, 1-10 mm pore length, 139- 254 x 122 – 190 μm pore diameter and 2-10 mm flesh thickness. Basidiospores were brown, ovate to ellipsoidal, truncated apex, double walled with inter wall pillars separating two walls. The size of these basidiospores showed variation in the range of 4.8-13 x 4.5-7.0μm with a spore index of 1.15-1.7. It was trimitic, with generative hyphae hyaline, thin walled, branched, septate and clamped. Reddish brown pigmented skeletal hyphae and colourless binding hyphae were noticed. Based on these observations the eight isolates of the pathogen were identified as Ganoderma lucidum (Leys) Karst. Regarding the in vitro management of the pathogen, two isolates of T. virens and one isolate of T. viride were isolated from rhizophere soil and were proved equally effective with the reference culture, T. viride and T. harzianum in inhibiting the growth of pathogen. Mycoparasitism and production of non volatile metabolites were found to be the mechanisms exhibited by the selected Trichoderma spp. The bacterial antagonists obtained from rhizosphere soil and the reference culture P. fluorescens recorded less than 50 percent inhibition on the growth except in cases of few isolates of the pathogen. It was observed that the selected bacterial antagonists were not much effective in inhibiting the pathogen compared to fungal antagonists. Among the phytoextracts, Azadirachta indica at 20 per cent concentration was found the most effective and recorded more than 50 percent inhibition on the growth of pathogen over control. It was followed by Musa sp. at 10 per cent concentration. The in vitro evaluation of fungicides showed that flusilazole, hexaconazole and iprobenphos at 0.2 per cent concentration were the most effective and recorded cent per cent inhibition on the growth of all isolates of pathogen. The study on the host range of G. lucidium revealed that the seedlings of arecanut, breadfruit, acacia and jack fruit showed yellowing and drooping of leaves and finally wilting of all the seedlings were observed
Open Access
Immunological and molecular detection of banana viruses and production of disease free planting materials
(Department of Plant Pathology, College of Agriculture, Vellayani, 2014) Aliya, Ferzana; KAU; Umamahesaran, K
The study entitled "Immunological and molecular detection of banana viruses and production of disease free planting materials" was conducted in College of . Agriculture, Vellayani, and Thiruvananthapuram during !he period of2011-2014. Symptomatological studies showed that the characteristics symptoms caused by BBTV were small, brittle leaves with thickened veins which remained bunched at the top of the pseudostem. Plants with early infection did not produce fruits, where plants with later infection produce bunch with reduced size, weight and mishapen fingers. The characteristic symptoms caused by BBrMV were reddish spindle shaped lesion in the pseudostem, flag leaf sheath, leaf petiole, and bract. Leaves of infected plants showed characteristic chlorotic spindle shaped lesion on the leaf lamina. The characteristic symptoms of BSV were chlorotic streaks in the leaf lamina. Later the chlorotic streaks became necrotic. The characteristic symptom of CMV was mosaic pattern in the leaf lamina. The pathophysiological studies conducted in cultivar Nendran revealed that there was significant difference in carbohydrate, chlorophyll, protein and phenol content in infected plant when compared to healthy ones .. The activity of defence related enzymes like peroxidase, polyphenol oxidase and phenylalanine ammonialyase were found to be more in infected plants. Electrophoretic analysis of protein in virus infected samples through SDS-PAGE revealed the presence of an additional protein in the protein profile. The protein profile of BBTV infected sample showed one extra band with molecular weight of 20 kDa, BBrMV infected sample showed three additional protein band with molecular weight of 38 kDa, 29 kDa and 22 kDa, BSV infected sample showed three additional proteins with molecular weight of 25 kDa, 19 kDa, and 12 kDa, CMV infected sample showed one extra band with molecular weight of 25 kDa. Electrophoretic analysis of isozyme though native gel revealed the increased action of peroxidase enzyme in infected sample. Detection of VIruS infecting banana was carried out using varIOUS immunological techniques such as DAC-ELISA and DIBA using polyclonal antiserum (Agdia) and monoclonal antiserum. Both the techniques were found to be efficient in detecting virus infecting banana. Molecular diagnosis of the BBTV was carried out using CP gene and replicase gene specific primers. PCR product with amplicon size of about 530 bp was observed for coat protein gene specific primer where 237 bp was observed for replicase gene specific primer. Molecular diagnosis of BSV was carried out using two CP gene specific primers resulted in PCR product with amplicon size of 664 bp and 730 bp. Molecular diagnosis of CMV was canied out using CP gene specific primer resulted in PCR product with an amplicon size of 687 bp. CP gene specific primer for BBrMV did not give positive result. Cluster dendrogram analysis revealed that the BBTV isolate was mostly related to BBTV coat protein gene of Burundi isolate, BSV isolate was mostly related to banana streak virus isolate Trichi, CMV isolate was mostly related to cucumber mosaic virus isolate Trichi coat protein gene. The meristematic region of the virus infected banana suckers were excised and inoculated to MS media with BAP and NAA. The regeneration of plants from meristematic region was difficult because of high phenol production and contamination by endogenous bacteria. Meristem culture eliminated BBTV, CMV and BBrMV but not the BSV. Based on the research result, the banana VIruses can be detected usmg immunological and molecular technique and the meristem culture can eliminate all the banana viruses except BSV.
Open Access
Symptomatology and molecular diagnosis of banana streak virus disease.
(Department of Plant Pathology ,College of Horticulture, Vellanikkara, 2011) Divya, C R; KAU; Anitha Cherian, K
The banana (Musa spp.) is a crop of global importance in terms of income security to million of small farmers throughout the developing countries. It is the world's fourth most important commodity after rice, wheat and corn and is produced in tropical and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria and viruses. Among the viral diseases, Banana streak is now emerging as a major disease affecting banana production world wide. This disease assumes significance as it affects plant growth, fruit yield and quality. It is also causing problems to germplasm exchange and in the certification of in vitro plantlets for international trade. The present project was undertaken to study the symptomatology of Banana streak disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of Banana streak virus, to standardize molecular indexing of planting materials of banana and to identify the source of resistance in the field gene bank. The symptoms of the disease appeared on different parts of the plant such as leaf lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later turned necrotic, blackened and running perpendicular to the leaf axis extending from midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina especially on older leaves. Dark brown coloured linear lesions appeared on other parts like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and death of cigar leaf was noticed. The plants showing such symptoms did not flower and resulted in 100 percent yield loss. The impact of the disease on biometric and yield characters was studied and observed that the disease affected the growth and yield of banana. A significant correlation was observed between the expression of symptoms with rainfall and temperature. The expression of the symptoms was more in cooler months and less in summer. The field gene bank comprising 290 accessions maintained at BRS, Kannara was screened to assess the reaction of these accessions to the disease. The disease incidence was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB), Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3 (AAAB). The percent disease incidence ranged from13.25 to 32.16 . The transmission studies proved that BSV was not transmitted mechanically or through infected soil. The insect vectors of BSV were proved to be two species of mealy bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The studies on virus vector relationship of these mealy bugs showed that the maximum acquisition feeding period, pre-acquisition fasting period, inoculation access period required for successful transmission were three days, one hours and seven hours respectively. The nymphs were more efficient vectors than adults. A minimum of thirty numbers were required for successful transmission of BSV. Plants inoculated with Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and in the case of Ferrisia virgata (Cockerell), it was six weeks. Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug has any role in the transmission of BSV. It was found that Geococcus sp. could not transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of Banana bunchy top disease had no role in the transmission of the virus. The studies on the transmission of the BSV through planting material proved that BSV is naturally transmitted through the planting materials of banana. PCR based molecular diagnosis is one of the reliable and quick method for the virus indexing of planting materials. The molecular diagnosis of BSV using polymerase chain reaction from infected samples was standardized using specific primers, (BSV 5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5' GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could be done directly from the crude sap, avoiding the step of DNA isolation. The outcome of this study will facilitate early detection and elimination of BSV infected plants and ensure distribution of healthy planting materials both suckers and tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well as the productivity of banana in the state.
Open Access
Management of blackeye cowpea mosaic virus using natural products from botanicals and the fungal root endopyte piriformospora indica
(Department of Plant Pathology, College of Agriculture, Vellayani, 2014) Chandran, K; KAU; Joy, M
The research work entitled “Management of Blackeye cowpea mosaic virus using natural products from botanicals and the fungal root endophyte Piriformospora indica” was conducted during the period of 2017-2019 at the Department of Plant Pathology, College of Agriculture, Vellayani to utilize natural products from potential antiviral plant extracts and the root endophyte P. indica for the management of the virus. Blackeye cowpea mosaic virus was maintained in systemic host, vegetable cowpea (var. Sharika) and the local lesion host, C. amaranticolor by sap transmission with phosphate buffer. Symptoms produced by BlCMV in emerging trifoliate leaves include vein clearing, vein banding and blistering, later it developed mosaic, leaf size reduction, leaf distortion, flower malformation, reduced pod length and stunting. It produced yellow chlorotic local lesion progressed to necrotic lesion in inoculated C. amaranticolor leaves. Beneficial fungal root endophyte, P. indica was maintained in PDA and PDB by frequent sub-culturing as when required. The fungi covered petri plate (9 cm) with PDA in nine days and in broth, 16 days for complete mycelial mat formation. Serological detection of the virus was done by DAC-ELISA and DIBA. Polyclonal antibodies of CABMV and PVY reacted positively with BlCMV infected leaves confirming the etiology of black-eye cowpea mosaic disease. Standardization of co-cultivation for P. indica with cowpea and C. amaranticolor were conducted in both in vitro and in vivo. The mycelium of P. indica was observed to colonize inside cowpea roots within 5 DAC. Chlamydospores were seen on root surface at 7 DAC and chlamydospores inside the roots at 14 DAC in both in vitro and in vivo methods. P. indica took much longer time for the colonization in C. amaranticolor roots. Mycelium was observed in roots at one week after co-cultivation (WAC) whereas chlamydospores at two WAC and chlamydospores inside the roots at three WAC in both in vitro and in vivo study. Ten plants with reported potential antiviral principles were screened against BlCMV in local lesion host, C. amaranticolor at 0.25, 0.5 and 1 per cent with pre- and post- inoculation method. P. niruri recorded more than 80 per cent inhibition of BlCMV local lesion in C. amaranticolor even at one per cent concentration by pre-inoculation method. B. diffusa inhibits 75 per cent of local lesions in C. amaranticolor at one per cent concentration in pre-treated plants. P. indica colonized in roots of C. amaranticolor with primed leaves could significantly reduce local lesion caused by BlCMV by 68 per cent over control. Water diffusible exudate from P. indica collected at different intervals was evaluated against BlCMV in local lesion host, C. amaranticolor with pre- and post- inoculation. Pi-WDE collected after three day mycelium incubation in sterile water was found to inhibit more than 75 per cent of local lesion over control. Bioassay in cowpea plants with best antiviral principles (P. niruri and B. diffusa), P. indica-priming and Pi-WDE were evaluated against BlCMV. P. indica-primed plants were less vulnerable to BlCMV infection followed by P. niruri pre-treated plants. BlCMV inoculated in P. indica-colonized plants enhanced root (22.7 g plant-1) and shoot (144.8 g plant-1) biomass which was significantly higher than the healthy plants. P. niruri pre-treated plants (root – 13.7 g plant-1 and shoot 113 g plant-1) were similar in biomass with healthy plants (root – 18.3 g plant-1 and shoot 124.3 g plant-1) while virus inoculated plants remarkably reduced root (4.6 g plant-1) and shoot biomass (12.4 g plant-1). Partial characterization of antiviral principles from best leaf extracts viz., P. niruri and B. diffusa against BlCMV in C. amaranticolor was done. Leaf extracts of both the AVPs were thermostable at 121°C for 20 min and partially photo sensitive (exposed natural light at 9 h). Proteins were the active principles found in the both the AVPs and had a molecular size of more than 1 kDa. Biochemical changes in host-pathogen interactions of pre-treated AVPs, P. indica-colonized and Pi-WDE treated cowpea plants were studied. Protein content of the virus inoculated plants increased initially up to 15 DAI, thereafter started to decline. Phenol content in healthy and virus inoculated plants increased with age of plants. P. niruri and B. diffusa treated cowpea plants induced rapid accumulation of phenol up to 10 DAI, later the induction was gradual. All the treated plants with the virus inoculation differs in PO activity, and its enhanced activity was in P. indica-primed and P. niruri treated plants at 10 DAI, later PO activity gradually declined in P. indica-primed while increased in P. niruri applied plants. Higher activity of PPO was observed in virus inoculated plants at 10 DAI, and the activity of PPO was significantly different with various treatments. Activity was enhanced during initial period of virus inoculation (upto 15 DAI), then the activity was reduced. Studies on PAL activity in cowpea plants treated with biotic agents and challenged with BlCMV inoculation resulted in the accumulation of PAL within 5 DAI, and there after decreased with age of plants except in Pi-WDE treated cowpea plants which enhanced PAL with age of plants. Protein profile study (SDS-PAGE) of cowpea plants revealed the induction of many proteins in response to the different treatments. Induction of PR-proteins was more in P. indica-primed plants with and without virus inoculation during the initial phase of the tripartite interaction. The intensity of band having molecular weight 29.4 kDa was high in all the treatments except for the virus inoculated plants. An extra band of 24.8 kDa was observed in P. indica-colonized virus inoculated plants. P. niruri constantly maintained high level of 34 kDa protein in treated plants whereas, in BlCMV treated plants, none of the PR-proteins were induced at different intervals of the experiment.
Open Access
Biological characterization of bud necrosis virus disease in watermelon(Citrullus lanatus T.)
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2014) Aswathi, K K; KAU; Vimi, Louis (Guide)
Watermelon, Citrullus lanatus (Thunb.), is an annual trailing creeper belonging to the family Cucurbitaceae. It occupies a pivotal position among fruit vegetables. Among the diseases affecting watermelon, those caused by viruses are difficult to control and can be very destructive. Recently, bud necrosis, a Tospovirus disease, has emerged as a serious problem of watermelon cultivation in Kerala. Not much work on the various aspects of the disease has been carried out. Further, little is known on disease incidence, severity and mode of transmission of the disease which are crucial for evolving appropriate management practices. Hence, the present project was undertaken to study the symptomatology, transmission, physical properties, host range and serological reaction of Watermelon bud necrosis virus (WBNV). Survey undertaken on the incidence and severity of the disease in major watermelon growing locations of Thrissur, Palakkad, Malappuram, Kasaragod and Kollam districts revealed the variations, based on the genotype, season and location. Under natural conditions, symptoms observed were curling, mottling, narrowing of leaf lamina, stunting, necrotic streaks on stem, unopening of flower buds and their necrosis, necrotic rings and malformation of fruits. Under artificial inoculation, symptom initiated as curling, crinkling and mottling of leaves, which later spread to young leaves and resulted in brittleness. The virus was isolated from symptomatic watermelon plants by mechanical transmission through a local lesion host Amaranthus viridis using potassium phosphate buffer pH 7.0. Transmission studies proved that WBNV transmitted both by sap and vector. Citrate phosphate buffer 0.1M (pH 7.2) showed the maximum transmission (72.22 %) with the minimum incubation period (8 days) and was used for further studies. The insect vector of WBNV was identified as Thrips palmi Karny. Studies on virus vector relationships showed that the minimum acquisition access period and inoculation access period were 24 h and 48 h respectively. Physical properties of virus i.e., dilution end point, thermal inactivation point and longevity in in vitro were investigated and it was found that the virus was inactivated at dilutions between 10-2 and 10-3 and at temperatures between 45 and 500C. Longevity in in vitro was recorded as four h at room temperature (28± 2) and 24 h under refrigerated condition (80 C). Host range studies revealed that ridge gourd, bottle gourd, salad cucumber, bitter gourd, cowpea, groundnut and gomphrena could serve as collateral hosts of the virus. Serological tests using DAC – ELISA of WBNV revealed close relation of the virus with Peanut bud necrosis virus. Among the 22 genotypes of watermelon screened for response to the virus none of them showed resistance. However, WMH531 and WMH 12031 recorded the lowest incidence of 10 and 8.33 per cent respectively, while the highest (96 per cent) was in NS 295 hybrid.
Open Access
Characterisation and management of tomato leaf curl virus in Kerala
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2014) Arun, Paul; KAU; Sally, K Mathew
Tomato is one of the popular and widely grown vegetables in the world. Occurrence of diseases acts as the major constraint in the cultivation of tomato in Kerala. Recently, tomato leaf curl, a whitefly vectored gemini virus, has emerged as a serious threat to tomato cultivation. Considering the importance of tomato leaf curl disease (ToLCD) in the state, Kerala Agricultural University has initiated research on developing resistant varieties against this disease. The present study was undertaken, giving emphasis on the molecular variability, and disease management aspects. Survey undertaken to record the incidence of ToLCV in Palakkad and Vellanikkara revealed that, the incidence varied from location to location and also from season to season. Disease incidence was less during September to December and severe in summer season recording 74 to cent per cent in Palakkad and 64- 83 per cent in Vellanikkara. Four different types of symptoms were seen associated with ToLCV affected plants. In transmission studies, grafting and the vector, Bemisia tabaci were able to transmit the disease with production of all the types of symptoms on healthy plants. Serological studies using DAC – ELISA revealed close relationship of ToLCV with African cassava mosaic virus and thus confirmed the association of gemini virus in the four different types of symptoms understudy. The protocol suggested by Rogers and Bendich (1994) with slight modification was found to be best for extracting the DNA from ToLCV infected plants. The presence of ToLCV in the four types of symptoms under investigation was confirmed with the PCR amplification with primers CRv301F and CRc 1152R. The coat protein gene from the samples were amplified and sequenced. The phylogenetic analysis of the four sequences revealed, differences in nucleotide sequence`. Yellowing and curling and curling with purple tint types symptom producing strains were found identical to the reported strains of ToLCVK3 and ToLCVK5 with DNA-A component. The upward curling and cupping type and curling and rolling type showed homology to Ageratum yellow vein mosaic virus and Pepper (Chilli) leaf curl Pakistan virus respectively with respect to the coat protein region. In the management studies, all treatments were superior to control. Among the 16 treatments, the combined spray of imidacloprid and the botanical, Perfekt showed 80.84 per cent disease reduction and highest yield. In addition, imidacloprid alone, Perfekt alone and Pseudomonas fluorescens + Perfekt were also effective. Thus, the present study augmented our understanding of the various aspects of tomato leaf curl disease in Kerala specifically, the symptomatology, molecular characterization and disease management strategies.
Open Access
Foliar fungal pathogens associated with yellowing disease of coconut.
(Department of Plant Pathology, College of Agriculture, Vellayani, 2011) Anju, C; Suharban, M
The study entitled ‘Foliar fungal pathogens associated with yellowing disease of coconut’ was conducted at the Department of Plant Pathology, College of Agriculture, Vellayani. A detailed survey was undertaken to study the incidence and intensity of Root (Wilt) Disease and Yellowing disease in the Instructional Farm, Vellayani. Both the diseases were observed in all the six blocks of the Farm. Out of 6107 palms in the farm 561 palms were affected by Root (Wilt) Disease (9.19 %) and 127 palms (2.08%) were showing symptoms of Yellowing disease. A total of 242 (43%) Root (Wilt) affected palms and 94 (74%) Yellowing disease affected palms are to be cut and removed since they are unproductive. The characteristic symptoms of Root (Wilt) Disease were flaccidity, ribbing, yellowing and necrosis. The Root (Wilt) Disease affected palms (42%) were ‘super infected’ with leaf rot disease also. In Yellowing Disease affected palms sudden appearance of chlorosis/ yellowing/ bronzing of one or more leaves in the middle whorl coupled with flaccidity was the characteristic symptom. Rapid drying and necrosis of inflorescence, abnormal shedding of flowers, buttons, immature nuts and mature nuts occurred in succession either simultaneously or prior to yellowing and the palms became barren within a short period. On the chlorotic/ yellowed leaves intense brown to black leaf spots developed which enlarged, coalesced together and blighted the leaflets. The affected palms usually succumb within a short span of time. Foliar fungal pathogens associated with leaf spots/ blights on the symptomatic leaves of Yellowing disease affected palms were isolated and the pathogenicity was proved. On artificial inoculation on detached spindle as well as mature leaflets, the pathogens produced tiny brown water soaked lesions of angular or oval or irregular shapes. Among the different pathogens Chalara fimbriata was the most virulent one. Based on the morphological and cultural characteristics the following foliar fungal pathogens on Yellowing disease affected palms were identified: Alternaria alternata, Aspergillus niger, Colletotrichum gloeosporioides, Cephalosporium spp., Chalara fimbriata, Curvularia spp., Fusarium verticillioides, F. semitectum, Lasiodiplodia theobromae, Pestalotiopsis maculans, Pestalotiopsis palmarum, Phomopsis spp., Arthrinium spp. and Verticillium spp. Among them, L. theobromae, C. gloeosporioides and P. maculans were the most frequently isolated pathogens. The biochemical analysis revealed that total sugars, total soluble proteins and phenylalanine ammonia lyase activity were higher in the leaves of diseased palms. Among the nine fungicides tested in vitro, Propiconazole, Tebuconazole and Mancozeb were found to be equally effective against L. theobromae, C. gloeosporioides, P. maculans and F. verticillioides.
Open Access
Studies on transmission, host range and management of ash gourd mosaic disease.
(Department of Plant Pathology, College of Horticulture, Vellanikkara, 2011) Divya, M; KAU; Vimi, Louis
The present investigation, “Studies on transmission, host range and management of ash gourd mosaic disease” was undertaken in the Department of Plant Pathology, College of Horticulture, Vellanikkara during 2009-2011 with an aim to study the symptomatology of the mosaic disease, mode of transmission, host range of the virus, the resistance of available genotypes to mosaic under net house conditions and to evolve a suitable management practice under field conditions. The sampling survey for the collection of mosaic samples conducted in different locations of Thrissur district revealed the incidence of five types of mosaic symptoms viz., marginal yellowing, yellow-green patch, severe puckering, filiform type and light and dark green patch type on ash gourd leaves. The marginal yellowing was found to be the prominent type of symptom compared to the other four types of mosaic. Under natural condition, yellowing of leaf margin was the major symptom of marginal yellowing type mosaic. But under artificial condition, yellowing of veins and veinlets of the leaf starting from the margin was the prominent symptom. In sap transmission studies, citrate phosphate buffer (0.1 M, pH 7) gave maximum disease incidence (73 per cent) with 23-28 days of incubation. In vector transmission studies, Aphis gossypii gave 59.5 per cent disease incidence and Bemisia tabaci, was unable to transmit the virus. Biological indexing was done on Petunia hybrida and Vigna unguiculata to identify different viruses infecting ash gourd. Dark necrotic spot was produced in P. hybrida on inoculation with yellow-green patch type and severe puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Chlorotic spots were produced in V. unguiculata on inoculation with yellow-green patch type and puckering type mosaic whereas systemic infection was produced on inoculation with filiform type. Symptoms were not produced on inoculation with marginal yellowing type in P. hybrida and V. unguiculata. Based on the symptoms produced on V. unguiculata, it was ascertained that the virus causing yellow-green patch type mosaic belong to Cucumber mosaic virus group and the virus causing filiform type of mosaic belong to potyvirus group. The electron microscopic study of the marginal yellowing type and puckering type revealed that they also belong to potyvirus group. Host range studies of the ash gourd mosaic revealed systemic infection in snake gourd, bottle gourd, ivy gourd, tomato, chilli and cluster bean. Screening of 15 ash gourd genotypes against mosaic disease, revealed that one genotype, Jeevas was resistant to the mosaic with no disease incidence and one genotype BH-205 was moderately resistant (10 per cent incidence). The genotypes BH-206, BH-210, Indu, BHF-2, BHF-3, BHF-4, BHF-6, BHF-7, BHF-8 and BHF-9 were moderately susceptible (20-50 per cent incidence) and BH-216, BH-219 and BHF-5 were susceptible (70 per cent incidence) to mosaic. Field experiment conducted to evaluate the effect of botanicals, biocontrol agent and chemicals on ash gourd mosaic revealed that all treatments reduced disease incidence, severity and coefficient of infection and increased yield and among them quinalphos (0.05%) was the best. From the above study, it was concluded that marginal yellowing, yellow-green patch, puckering and filiformy were the major types of ash gourd mosaic and among them, mosaic with marginal yellowing symptom was the prominent one. The ash gourd mosaic was transmissible through sap and aphid. The virus causing marginal yellowing type mosaic belonged to potyvirus group. Snake gourd, bottle gourd, coccinia, tomato, chilli and cluster bean were found to be collateral hosts of the virus. Jeevas, a local genotype was identified as a resistant variety to ash gourd mosaic. The results of field experiment revealed that quinalphos (0.05 per cent) showed maximum effect in reducing mosaic infection.

Kerala Agricultural University, Thrissur

Browse

Thesis Type

Type

Author

Date

Subject

Search Results