Thumbnail Image

Birsa Agricultural University, Ranchi

Browse

1984 - 198972010 - 20151
Reset filters
Subject: Animal Genetics and Breeding × End date: 2019 × Type: Thesis × Thesis Type: Ph.D ×
Reset filters

Search Results

Now showing 1 - 8 of 8
  • Thumbnail Image
    ThesisItemOpen Access
    Studies on genetic and phenotypic parameters of some economic traits in different grades ofcross-bred (Friesian X Zebu) Cattle
    (Birsa Agricultural University, Ranchi, 1984) Siya Ram Singh; H. R. Mishra
    Conclusions # On the basis of the findings of this investigation, the following conclusions were drawn – (1) Among Friesian X Sahiwal cross-bred grades, half-breds were superior in respect to body-weights at different ages. (11) Body-weight at 6 months of age can be used as a selection criterion, with considerable accuracy, for higher body-weights at different ages, higher first lactation yield, cumulative milk yields in first three and four lactations and better milk producing efficiency in Friesian X Sahival cross-breds. (111) Half-breds were also superior among all Friesian cross-bred grades, so far as lactation yield; peak yields cumulative milk yields in first four and five lactations; average milk yields per day of lactation length and calving-interval; service period and inter-calving period were concerned. However, cous having 62.5% Friesian inheritance had shortest average age at first calving as well as ary period and highest MPEK and MPEKD values among all Friesian X Sahiwal cross-bred grades under reference. (iv) The results of Multivariate analysis indicated that it cannot be assumed that grading up of Sahival cattle to the total replacement of their genes by those of Friesian origin, will lead to higher level of production.
  • Thumbnail Image
    ThesisItemOpen Access
    A Study On Cross Breeding Of Desi With Landrace And Large White Yorkshire Pigs
    (Birsa Agricultural University, Ranchi, 1989) Sharma, Banshidhar; H. R. Misra
    1.Landrace is more suitable for farm owing to its physical conformation and inherent genetic potential of faster growth at the finishing stage, whereas, Large white Yorkshire being more adaptable to rural condition with comparatively high post-weaning shock tolerance capacities stands ahead of the former for distribution in villages where its halfbreds perform better then Landrace halfbreds. 11. A decrease in magnitudes on pre-weaning body weights and linear body measurements with the increase of litter size at birth seemed to be a decisive factor of considerable importance in selection for phenotypic traits. 111. The lower rate of growth just after weaning in almost all the genetic groups suggested need of special care and management at that stage. 1V. Because of high resistance of weaning shock in halfbreds they excel the exotic over preference for any developmental programme in rural areas. If at all, exotics do not merit such consideration until they have crossed the weaning period at least by over one month. V. A significant superiority in litter size, apart from litter weight at birth and at weaning, is an additional advantage in economic traits by crossing of Desi sows with exotic boars over indigenously bred sows with Desi male.
  • Thumbnail Image
    ThesisItemOpen Access
    Genetic Architecture of Growth, Production And Reproduction In Black Bangal And Its Half- Bred Goats
    (Birsa Agricultural University, Ranchi, 1989) Singh, Lal Babu; H.R. Misra
    1.Beetal halfbrede vere superior to Jamunapari halfbreds and purebred Black Bengal in body weights during early stages of growth. The superiority declined with age. (2)The results suggested need of special care to both the balfbrede during initial post-weaning period for maintaining proper growth. (3) Phenotypic correlation of 3-month body weight with other growth trait in later ages was high in magnitude and might be the appropriate weight for selection for maximizing the weights during later part of life in all the three genetic groups. (4) Due to high genetic correlation of 3-mouth body weight with other growth traits, selection for higher body weight could be made on 3-month body weight. (5) The estimates of genetic trends revealed consider able genetic improvement in most of the traits. But all these seemed to be aullified by environmental trend which were in opposite direction. As a result of this, the desirable increase in body weights of Black Bengal due to genetic trend could not be exploited phenotypically.
  • Thumbnail Image
    ThesisItemOpen Access
    Studies On Response And Correlated Response To Selection In Mice
    (Birsa Agricultural University, Ranchi, 1989) Nath Surendra; R. L. Singh
    Based on the results of this study the following: Conclusions may be drawn: 1. The body weight and tail length at 6 weeks of age were found to be moderately heritable in the base population. 2. The genetic and phenotypic correlations between the two traits were found to be positive and high in magnitude. 3. The expected and realized cumulative selection differential consistently increased over generations in all the lines. 4. The response to selection for 6-week body weight was almost consistent over generations. However, discrepancy existed between the expected and observed responses. 5. The effect of selection, generation and generation x selection with respect to body weight and tail length at 6 weeks of age were highly significant. There was marked departure from linearity in the trend of improvement in the mean values over generations. The selection was found to be more effective in females than males, 6. The response was markedly high at 50% level of selection than that of 75% for body weight. 7. The correlated response of 6-week body weight while selecting for tail length and vice versa were found to have increasing trend and were mostly consistent over the generations.
  • Thumbnail Image
    ThesisItemOpen Access
    Genetic Analysis Of Some Milch And Reproduction Characters In Goats
    (Birsa Agricultural University, Ranchi, 1988) Mukherjee, Dev Kumar; C.S.P. Singh
    This study indicated that Beetal half-breds produced more milk than the Jamunapari half-breds under semi-intensive (Farm) and extensive (Village) manage mental systems. The milk yield increased with parity up to 3rdlactation after which it declined. Twin producing goats of all the three genetic groups had higher milk yield than the single producers. Persistency of milk yield was the highest in Beetal half-breds and lowest in Black Bengal goats. Life time milk production up to 4th lactation may be reliably predicted with the help of 1st lactation yield. The animals born single came in 1st heat earlier than those born as twins. Similar trend was observed forage at 1st kidding also. The trend of production and reproduction performances of the goats under extensive system was almost the same as that of organized herd. The effect of herd wise was not significant on any production and reproduction traits under extensive system of management.
  • Thumbnail Image
    ThesisItemOpen Access
    Studies on Two way family selection for Egg Production and Its Correlated Responses to some unselected Fitness Traits in Trinolium Castaneum
    (Birsa Agricultural University, Ranchi, 1986) Verma, Shashi Bhusan; Singh, R.L.
    The effects of selection, generation and generation x selection with respect to total egg production (eth-10th day egg number) were highly significant (P/ 0.01) in both the high and low lines. The replicate, generation x replicate and selection x replicate effects were non-significant. In the high lines the phenotypic and genetic responses vere larger at higher intensity of selection. In all the high and low lines there was good agreement between the average realised and predicted responses per generation for the selected trait. There was symmetry in response for the high and low lines at both the selection intensities. For each selection intensity the divergence increased gradually between the two lines. The trend of observed correlated responses in 8th, 9th and 10th day egg number was positive through out the experimental period. The trend in hatchability was, in general, positive. As regards, pupation time and adult emergence time the trend was in negative direction. There was fair agreement between the observed and expected correlated responses with respect to 8th, 9th and 10th day egg number. The realised correlated responses for hatchability, pupation time and adult emergence time, however, fell short that of the predicted ones.
  • Thumbnail Image
    ThesisItemOpen Access
    Studies on the construction of Selection indices on Broiler Birds
    (Birsa Agricultural University, Ranchi, 1984) Akhtar, S.M. Humayun; Mishra, H.R.
    The investigation reported in this thesis van based upon the experiments conducted on 833 Red Cornish and 1,792 shite Rock birds (belonging to 44 and 05 siren respectively) procured from Central Avian Research Institute, Izatnagar and subsequently maintained at the Experimental poultry Unit et Ranchi Veterinary College, Ranchi, and vas planned with the following objectives: 1. To estimate the genetic and phenotypic architecture with respect to broiler and production traits of the two above mentioned breeds. 2. To construct several selection indicens separately for male and female lines involving some economic traits. 3.To estimate responses in the constituent traits and also in aggregate genetic economic value in each case consequent upon one round of index selection. 4.To compare the efficiency of the tandem, independent culling level and index selections. 5.To construct restricted selection indices imposing restriction on one or two traits at a time and to estimate the genetic cost of imposing restriction in each case. 6.To construct selection indices for multi-stage indox selection and to evaluate their efficiencies.
  • Thumbnail Image
    ThesisItemOpen Access
    TLR6 GENE POLYMORPHISM AND ITS ASSOCIATION WITH IMMUNE RESPONSE AND DIFFERENT ECONOMIC TRAITS IN PIGS.
    (2015) KUMARI, NANDANI; SINGH, L. B.
    In the most recent decade, the population of swine has declined to approximately 12 million head from a high of 14 million in 2003, as indicated by the 17th Livestock Census of India. Industry sources suggest that this decline may be due to animal disease outbreaks. Hence, livestock breeders and geneticists now focus attention towards proper utilization of disease resistance aspect of our live-stocks. Among the different genes involved in immune response of different livestock particularly pig, TLR (TOLL-LIKE RECEPTOR) gene is of prime importance in innate immunity response. Polymorphisms and/or differences in the production of immune molecules, such as TLRs, have a profound influence on responses to a wide range of pathogens and are associated with resistance and susceptibility to diseases (Lazarus et al. 2002). So far, 13 members of the TLR family were identified in mammals (Beutler, 2005). Studies with dominant negative receptors have shown that TLR6 cooperates with TLR2 to recognize peptidoglycan and the yeast cell wall particle. Furthermore, TLR6 deficient mice were reported to be hyporesponsive to mycoplasma macrophage-activating lipopeptide-2 kD (MALP-2), a diacylated lipoprotein, suggesting that and TLR6 coordinate the response to this ligand. Hence TLR6 have the potential to become candidate gene for marker assisted selection for disease resistance that could be exploited by breeding strategies. Keeping this in view, the present investigation was carried on with two objectives, first to find out polymorphism in porcine TLR6 gene in Tamworth, Desi and T&D groups of pig and secondly to estimate the association between SNPs in TLR6 gene with the economic trait namely body weight at birth. A total of 48 pigs from three genetic groups namely Tamworth, Desi and T&D maintained at Pig farm Ranchi veterinary College were utilized for this investigation. Observations of weight at birth(Birth weight) of all the 48 animal were taken under controlled managerial conditions. The antibody response to SRBC was assessed by haemagglutination test (according to procedure of Siegel & Gross 1980). Further blood (5ml.) was collected along with anticoagulant from each of the experimental animal. Genomic DNA was isolated and purified from white blood cells using proteinase-K digestion and standard phenol -chloroform extraction as per the standard protocol described by Sambrook,et.al.,(1989).Nine pairs of synthetic oligonucleotide/primers(One forward and another backward) were required to prime DNA amplification to see the polymorphism in TLR6. To explore genetic polymorphism in TLR-6 gene, amplified PCR products were subjected for SSCP through polyacrylamide gel electrophoresis. Silver staining method was described by Bassam, et. al.,(1991). The data were statistically analyzed with available computer software SPAB and Least Square Analysis Harvey’s model(1990). Haplotyping based on the bands obtained were analyzed and confirmatory sequencing was done from Xcleris lab. Further Phylogenetic analysis was done to construct the evolutionary tree based on the sequence on Sus Scrofa TLR6 gene using BLAST software (NCBI) website. Polymorphism With the 1st primer having forward and reverse base sequences as TTTGGATGCCTAGCAAAGATA and GGGATGGCACTTTTCCAGAT respectively, six different haplotypes namely A, B, C, D, E, & F were obtained. Under 2nd primer with forward and reverse base pairs as GCAGCTGACGGTTTTGAGA & GGGATGGCACAAGATTGTCT respectively, three different haplotypes namely A, B & C were observed. The third primer of TLR 6 with forward and reverse base sequences as TCGGTTAAGAGAGTGTAGGGTGTTT and GGTACCTGAGGAGCGTAA respectively, five haplotypes were obtained and they were designated as A, B, C, D, E, and F. In case of fourth primer having forward and reverse base sequences as TTGGCCCAAACCTGTAGAAT and CCAACCCAAGTGCAAT, no amplification was obtained despite repeated PCR amplification. Even the optimization didn't yield any result for this primer. The 5th primer having forward and reverse base sequences of GTCCTGAGGTACCAAGCACA and TGGAAAGGCTGCTAAAGGAA respectively yielded four haplotypes namely A, B, C, and D. For 6th primer with forward base sequence as GAAAATTGCACTTGGGTTGG and reverse base sequence as ACGGAAGTCCTTGAGCAGAG, four haplotypes coded as A, B,C and D were found. Under the 7th primer with forward and reverse as TTCCTTTAGCAGCCTTTCCA and GAAGGCATGGAACTGGAGAG, a total of six haplotypes namely A, B, C, D, E and F were obtained. In case of 8th primer having forward and reverse base sequences as CTGGCATTGGCTCTTACCAT and TAAGTTCGTGTGCCATGAG, a total of four haplotypes were obtained. They were termed as A, B, C, & D. In case of 9th primer having forward and reverse base sequences CATTGAGAAAAGCTACAA and GGAGGTTATGGAGGTATCGTC three haplotypes namely A, B, and C were obtained. Haplotype frequency : For the first primer (TLR6-1) gene, in Desi, the highest genotype frequency (35.71%) was observed for haplotypes A&B and in Tamworth population haplotype B (57.41%) had the highest frequency while for T&D population, haplotype A had the maximum (45.00%) frequency. For the 2nd primer (TLR6-2) in the Desi population, haplotype A (92.86% ),in Tamworth, haplotype A (71.42), and for T&D Haplotype C (75.00%) had the highest genotype frequency.For the 3rd primer(TLR6-3), in case of Desi, Tamworth and T&D ,haplotypes B (57.41%), haplotype B (78.57 % ), haplotype D (65.00%) had maximum values respectively. For the 5th primer (TLR6-5), in case of Desi population, haplotype A (57.14%) in Tamworth, haplotypes A and C ( 35.71% ) and in T&D, haplotype C (60.00%) had maximum genotype frequency. Haplotype A (85.71%) , haplotype D (71.43%) and haplotype C (45.00% ) had the maximum value for Desi. Tamworth, and T&D, respectively for the 6th primer (TLR6-6). In case of 7th primer(TLR6-7) for Desi population, haplotype A had maximum value of 64.29% .Haplotype B with 50.00% had the highest values of genotype frequency for Tamworth. For T&D, haplotypes B and D had a genotype frequency of 50.00%. For 8th primer (TLR6- 8),Haplotypes B and C had highest genotype frequency of 28.57% Tamworth had the highest genotype frequency of 57.14% for haplotype B. For T&D haplotypes C&A had the highest value of 35.00%. Haplotype A (85.71% ), haplotype A (71.43%) and A (55.00%) had the highest values respectively for Desi, Tamworth and T&D for the 9th primer(TLR6-9). Association of TLR6 gene polymorphism with different economic traits: Polymorphic patterns of TLR6-1 gene indicated that SNP genotypes were significantly associated body weight at birth. Polymorphic patterns of TLR6-2 gene indicated SNP genotypes Haplotypes had non-significant effect on traits under study. Polymorphic patterns of TLR6-3 indicated that haplotypes had non-significant effect on other traits except for body weight at 42- day. Polymorphic patterns of TLR6-5 indicated that haplotypes for primer -5 (TLR6-5) had nonsignificant effect on all the traits. Polymorphic patterns of TLR6-6 indicated that haplotypes had non-significant effect on all the traits under study. Polymorphic patterns of TLR6-7 indicated that out of all the traits under study, the haplotypes had significant effect on body weight at birth and body weight at 42-day and on body weight at 56-day.Polymorphic patterns of TLR6-8 indicated that haplotypes had non-significant effect on all the traits under study.Polymorphic patterns of TLR6-9 indicated that out of all the traits under study, the haplotypes had significant effect on litter weight at weaning. Impact of piglet’s immune response on growth of piglets : Piglet’s titre had significant effect on body weight at 42-day. High responder piglets had heavier birth weight and body weights at 7-day, 14-day, 28-day, 42-day and also at 56-day of age than those of low responder piglets. Impact of Piglet’s immune response on Body weights gain at different ages. High responder piglets had heavier body weight gain during birth and 7-day, 14 and 28-days and 28 and 42-day.While high responders had lower body weight gains for 7 and 14-day and 42 and 56-day. Impact of piglet’s immune response on reproductive traits: Effect of piglet titre on litter size at birth was non-significant with a mean of value of 09.649 ± 09.1357 for low responders and 09.107 ± 08.2528 for high responders respectively. Nonsignificant effect of piglet titre on litter weight at birth was reported with the mean value being 10.649 ± 00.9326kg and 11.301 ± 01.0323 kg respectively for low responders and for high responders . Piglet titre had non-significant effect on litter size at weaning. Non significant effect of piglet titre on litter weight at weaning was reported with low responders and high responders having the mean value of 75.040 ± 09.1357kg and 72.067 ± 08.2528kg respectively. Effect of genetic groups on reproductive traits: The four reproductive traits for study were litter size at birth, litter weight at birth, litter size at weaning and litter weight at weaning . Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and di ffered non-significantly from TxD (10.727 ± 01.0906 kg). Effect of genetic groups on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Significant effect of genetic groups (p<0.05) was reported on litter weight at birth. Tamworth with 14.276 ± 01.5197 kg was significantly higher than desi (04.892 ± 01.8131) and differed non-significantly from TxD (10.727 ± 01.0906kg). Effect of genetic groups (Table 4.30) on litter size at birth was found to be significant (p≤0.05). Tamworth with 11.421 ± 01.2589 litter size at birth was higher than that of T&D and Desi. Desi with 05.920 ± 01.1998 was the significantly lowest followed by TxD with 09.856 ± 00.9034 and these two different non -significantly between the two. Least squares analysis of variance showed the significant effect of genetic groups on litter size at weaning (p≤0.05). The result revealed that significantly highest litter size at Weaning was found to be 11.247 ± 01.0057 in Tamworth followed by TxD (08.535 ± 00.7217) and then lowest value for Desi was 05.556 ± 01.5019.Least squares analysis of variance indicated the nonsignificant effect of genetic groups on litter weight at weaning. TLR6 gene sequence analysis under different primers : The PCR products representing different SSCP patterns in swine resource population of present study were directly sequenced using DNA sequencing service (Xcelris Hyderabad). The nucleotide sequence alignments were carried out using alignment tools, viz. Clustal W (DNA star Inc. USA) and BLAST to reveal single base variations. These allelic variants in the sequence of nucleotide were analyzed. The DNA sequences showing polymorphism were used to identify SNPs. Under the TLR6-1 primer, principal SNPs were found at positions 59, 61, 66, 75, 155, 189, 288 and 371 of nucleotide bases. With respect to the second primer of TLR6 gene, principal SNPs were found at positions 66,69,71,72,73,77,79,402,512,519,520,521 and 522 of the nucleotide bases. Third fragment of the TLR6 exhibited the principal SNPs at positions 19, 20, 22, 25, 28, 29, 330, 347, 384, of the nucleotide bases. The fifth primer of the TLR6 exhibited the principal SNPs at positions 61, 64, 65, 70, 225, 235, 275, 285, 289, 302 and 303 of the nucleotide bases. Principal SNPs were observed at positions5,6,7,8,34,63,64,136,179,185,186,187,188,189,190,191,192,197,203-208,222, 208, 367, 388, 408, 409 and 410 . 4, 5, 6, 7, 54, 59, 262, 317, 397 and 406 were the main positions at which SNPs were observed in case7th primer. In 8th primer the principal SNPs were found at 7, 8, 9, 13, 14, 59, 61, 62, 130, 148,149,154, 155, 156, 380, 395, 400, 403, for the 8th primer. The ninth primer of TLR6 gene exhibited the principal SNPs at positions 40,41, 42, 46, 47, 48,49, 52, 381, 382, 390, 393 and 394 of the nucleotide bases . Correlation of piglet titre with growth traits and reproductive traits: Correlation of Piglet titre was found to be positive in all other cases except for body weight (kg) at 14-day and weight gain (Kg) between 7-14 day. It was negative for these two growth traits. The correlation was significant only in case of Body weight at 42-day (P ≤ 0.05). Correlation of piglet titre with reproductive traits was found to be non-significant . Litter size at birth was positively correlated with HA titre Piglet titre was negatively correlated with all other traits i.e. Litter weight at birth and Litter size at weaning and Litter weight at weaning. Phylogenetic studies : In the current study, there were nine different primers of TLR 6 gene out of which eight were used for phylogenetic studies based on sequence data using the NCBI BLAST (as the 4th primer did not yield any result on amplification), the details were explained under following heads. Phylogenetic studies based on TLR6 gene fragment were studied figure showed the genetic distance among different species of animals with reference sequence ICI / 56329 of TLR 6 gene fragment. The sequence was found nearest to sus scrofa mRNA and TLR 6, TLR1 and TLR10.It was found to be most distant from Bubali bubalis and nearer to Equus Caballus than other domestic animals. The genetic distance among the different species of animals with reference sequence (ICI / 62869) gene fragment. It is nearest to TLR6, TLR1 and TLR10.Phylogeny based on this sequence showed that similar to it other domestic animals like buffalo, sheep and goat seems to have evolved from Equus Caballus . Phylogenetic studies based on TLR 6-3 gene fragments were studied and presented as Figure 4.39 which indicated the genetic distance among different species of animals with reference sequence ( ICI / 36573) of TLR 6-3 gene fragment .This fragment although was nearest to TLR 6 mRNA, it did not show any nearness to TLR1 and TLR10. With respect to TLR 6-5 gene fragment, phylogenetic studies were done. The genetic distance among the different species of animals with reference sequence ICI / 40627 of TLR6-5 gene fragment from which TLR6 mRNA and TLR 6,TLR 1and TLR10 seems to have evolved. Further based on this sequence sus scrofa is equidistant from other domestic animals w.r.t phylogeny. The genetic distance among the different species of animals with reference sequence ICI / 36573 of TLR6–6 gene seems to have evolved from Felis catus along with other domestic animals. Further the TLR6 gene fragment shows that sus scrofa is nearest to Equus Caballus and almost equidistant from other domestic animals like Bubalas bubalis, ovis aris and Bos indicus . As found according to the analysis, the genetic distance among the different species of animals with reference sequence ICI / 35303 of TLR 6-7 gene fragment. The fragment based phylogeny shows that swine is nearest to Equus caballusand most distant from ovis aries and capra hircus. Genetic distance among the different species of animals with reference sequence ICI / 37879 of TLR 6-8 gene fragment. The phylogeny revealed that it was nearest to Equus caballus. Phylogenetic analysis based on TLR6 gene fragment was studied and compiled as Figure 4.44 which contained the genetic distance among the different species of animals with reference sequence ICI / 25503 of TLR 6-9 gene fragment. It was found to be nearest to Equus Caballus and most distant from Bos Indicus and Bos Taurus among all. The PCR-SSCP analysis of TLR - 6 gene revealed the polymorphic pattern of genotypes in Swine. Presence of Different Haplotypes was evidence of allelic variants and hence polymorphism and mutations at different loci which could be studied and exploited for population and selection studies in swine. Significant association of TLR-6 gene polymorphism with the Humoral Immune response against SRBCs was observed. High responder piglets against SRBCs performed better than the low responders with respect to growth indicating its usefulness for designing breeding and selection strategies to develop lines with high immunity. The phylogenetic tree revealed the relative genetic distance of different germplasms of Swine under study. Based on the result, TLR 6 gene was found to be closer to TLR1 and TLR10. Further the evolutionary tree for majority of primers showed Sus Scrofa to be nearest to Equus caballus on the basis of sequence under consideration. The DNA sequences showing polymorphism were used to identify SNPs. SNPs were found at various positions in case of all the primers The SNPs on further study could help unravel many mysteries related to oncogeny and other disorders in the swine.