Loading...
Anand Agricultural University, Anand
Anand Agricultural University (AAU) was established in 2004 at Anand with the support of the Government of Gujarat, Act No.(Guj 5 of 2004) dated April 29, 2004. Caved out of the erstwhile Gujarat Agricultural University (GAU), the dream institution of Sardar Vallabhbhai Patel and Dr. K. M. Munshi, the AAU was set up to provide support to the farming community in three facets namely education, research and extension activities in Agriculture, Horticulture Engineering, product Processing and Home Science. At present there seven Colleges, seventeen Research Centers and six Extension Education Institute working in nine districts of Gujarat namely Ahmedabad, Anand, Dahod, Kheda, Panchmahal, Vadodara, Mahisagar, Botad and Chhotaudepur
AAU's activities have expanded to span newer commodity sectors such as soil health card, bio-diesel, medicinal plants apart from the mandatory ones like rice, maize, tobacco, vegetable crops, fruit crops, forage crops, animal breeding, nutrition and dairy products etc. the core of AAU's operating philosophy however, continues to create the partnership between the rural people and committed academic as the basic for sustainable rural development. In pursuing its various programmes AAU's overall mission is to promote sustainable growth and economic independence in rural society. AAU aims to do this through education, research and extension education. Thus, AAU works towards the empowerment of the farmers.
Browse
39 results
Search Results
ThesisItem Open Access TRANSCRIPTOME PROFILING TO EVALUATE EFFECT OF HERBAL PLANT EXTRACT ON BULL SPERMATOZOA(Department of Animal Biotechnology College of Veterinary Science and Animal Husbandry Anand Agricultural University, Anand, 2019) Jignesh M. Italiya; Prakash G. KoringaThe mammalian ejaculated spermatozoa are highly differentiated terminal cells with an extremely compacted nucleus of haploid genome. The mammalian spermatozoon transfers coding as well as non-coding transcripts to the oocyte during fertilization. Spermatozoal transcript composition and expression levels are associated with spermatogenesis, functional parameters of spermatozoa, early embryonic development and pregnancy outcomes. Putranjiva roxburghii wall which is known as child’s amulet tree or child-life tree. Bryonia laciniosa is an herb, which has been included in Vrishya rasayana category in Ayurveda texts. It is also used traditionally as an aphrodisiac and pro-fertility compound. Hence this ethno-herb has immense potential of research in the field of infertility of either sex. On the basis of hypothesis that, any environmental disturbance in form of given treatment of herbal seed extract to spermatozoa that makes change in transcriptome profile, the current study is planned to establish the fact about effect of herbal preparations on sperm mortality, viability and RNA profiling.ThesisItem Open Access Application of Real Time PCR assay for quantifying bacterial density in the rumen of Goats fed tannin rich diets(AAU, Anand, 2009) SONI, PRASHANTKUMAR SURESHBHAI; Pandya, P. R.India possess second largest population of Goats. Grazing goats are the backbone of most of the world's marginal land enterprises. They are capable of utilizing effectively a vast variety of plant species and vegetation types including unconventional feeds. Goats are normally habituated to eat vast variety of tree leaves which usually contain anti-nutritional factors like tannins. Their tannin tolerance is higher than other livestock. This may be due to speciaUzed microbial ecosystem. Present study was aimed to explore the effect of tannins on ruminal microbes using real time PCR approach. Tannins are most effective against the fiber-degrading (cellulolytic) bacteria like Fibrobacter succinogens, Riiminococcus species, Butyrivibrio fibrisolvens, Ruminobacter amylophilus. The ruminants which continuously feed upon diets rich in tannins usually develop a microflora which is tolerant to high tannins such bacteria includes Streptococcus capriniis, Streptococcus bovis, Selenomonas ruminantium, Clostridium species and class proteobacteria. The experiment was conducted on eight adult goats divided into 4 groups viz. Tl: control (0% acacia nilotica pods in TMR, 0% tannin), T2: 25% acacia nilotica pods in TMR (3.5% tannin), T3: 43% acacia nilotica pods in TMR (6% tannin) and T4: 59% acacia nilotica pods in TMR (8.5%) tannin). The Total Mixed rations with different levels of Acacia pods were produced and fed to respective goats ad lib. Rumen liquor (200 ml) was collected on 0, 15th and 30th day of experiment at 0, 3 and 6 hrs post feeding from each animal to study the effect of tannins on bacterial population. The bacterial DNA was extracted from pooled samples of both animals in each group by enzyme-chemical lysis method from rumen fluid. The DNA stock samples were quantified using Nano-drop spectrophotometer at 260 and 280 nm. Purity of DNA was judged on the basis of optical density ratio at 260:280 nm which was between 1.8 to 2.0 for all the samples indicating desirable purity. Species specific primers were used to amplify the bacteria (Selenomonas niminantium, Streptococcus bovis, Fibrobacter succinogenes, Treponema bryantii, Anaerovibrio lipolytica, Total Bacteria, Prevotella ruminicola, Ruminococcus albus, Methanobacteriales and Methanomicrobiales targeting 16S rRNA gene were used for amplification of DNA. The amplified products were visualized as a single compact band of expected size under UV light. The PCR products were purified by eluting the PCR product from the agarose using QIAquick Gel Extraction Kit - Qiagen and were ligated in pTZ57R/T vector of InsT/Aclone TM kit (Fermentas). This was followed by transformation into competent cells (DH5-α strain) of E.coli. Recombinant colonies were picked up by Blue white screening. White colonies were confirmed for presence of insert by colony PCR using M13 primers. Recombinant colonies were inoculated in Luria Broth for 16-18 hrs. Plasmid extraction from overnight culture was carried out by using QIAprep plasmid extraction kit. The plasmids contain species specific amplified DNA fragment so these plasmids were used as standards while running the real time PCR. Their copy number was calculated using optical density and molecular weight of plasmids. The plasmids were serially diluted and standard plot was prepared and according to the plot, the concentration of amplified DNA and ultimately the bacterial population was measured. All samples along with standard plasmids were amplified with species specific primers using real time PCR. The population of bacteria Selenomonas ruminantiwn increased with increase in level of tannins in different group (1314% increase in group IV followed by 747% and 210%) in group III and II respectively at 30th day of experiment) of animals and also with period of experimentation (Increased with 844%) and 1314% at 15th and 30th day respectively in group IV). Similarly the population of Streptococcus bovis also increased with increase in level of tannins and with period of feeding (555%o increase in group IV at 30th day). The lipolytic bacteria Anaerovibryo lipolytica increased with increase in level of tannins in feed (3645% increase in group IV). The results revealed Selenomonas ruminantium and Streptococcus bovis as tannin tolerant bacteria. Tarmins have inhibitory activity against fibrolytic bacteria Fibrobacter succinigenes and reduction in population was more prominent at 30th day of experiment (decreased by 73%, 67%) and 57% in group FV, III and II respectively). Similar inhibitory effect (78% decrease in group IV) was also seen in Treponema bryantii which is saccharolytic spirochete and has been shown to be associated with the fibrolytic bacteria of the rumen. The population of proteolytic bacteria Prevotella niminicola was not affected at any level of tannins throughout the experiment. At low level (3.5%), tannins have beneficial effect on microbial growth for total bacterial population but no effect was seen at other levels. The population of methanogens of the order Methanobacteriales and Methanomicrobiales also remain unchanged even at the highest level of tannins. The population of Ruminococcus albus increased at 15th day with the highest in group FV (496%) followed by group III (416%) and group II (308%). At 30th day the population decreased compared to 15th day but remained at higher level to that of 0 day population. The study revealed that Selenomonas ruminantium, Streptococcus bovis and Anaerovibrio lipolytica are major tannin tolerant bacteria in goats. Tannins exert detrimental effect on fibrolytic bacteria like Fibrobacter succinigenes and Treponema bryantii. However no effect of dietary tannins was observed on Prevotella ruminicola, Methanogenes (Methanobacteriales and Methanomicrobiales) and total bacterial population in goats.ThesisItem Open Access Diversity and molecular characterization of ruminal bacterial flora of goats(AAU, Anand, 2009) Patel, Jayesh M.; Jhala, M. K.Rumen harbors diverse types of microbes mainly bacteria followed by protozoa, fungi and yeast. Bacterial population as high as 10 power 10 is found in rumen and has a profound effect on nutritional and physiological processes in the host. Much of the pioneering studies on the rumen microbiota are based on microscopic examination and anaerobic culture techniques. But the polymiorphic nature and the difficulty of cultivating the microbes have hampered effective assessment of ruminal ecology by these methods. Newer molecular approaches are available to identify and characterize the bacteria that are based on detecting highly conserved 16S rRNA gene regions. Molecular characterization of rumen microflora in Indian goat apparently has not been carried out yet. Present study was aimed to determine diversity and molecular characterization of ruminal bacterial flora of goats using 16S r RNA gene amplification, cloning and sequencing of gene followed by phylogenetic analysis. Five goats reared at Instructional farm managed by Livestock production and management department at College of Veterinary Science and AH., Anand, were used for rumen liquor collection using a flexible stomach tube. The bacterial DNA was isolated from strained rumen liquor following enzyme-chemical lysis method The quality and quantity of DNA stock sample was determined using Nano-drop spectrophotometer and agarose gel electrophoresis. Universal primers for bacteria 27F (5'AGAGTTTGATCCTGGCTGGCTCAG 3') and 1492R (5' GGTTACCTTGTTACGACTT 3') targeting 16S rRNA gene were used for amplification of DNA. The amplified product was visualized as a single compact band of expected size (1346 bp) by gel documentation system. PCR product was subsequently eluted from agarose gel and ligated in pDrive vector followed by transformation into competent E. coli (DH5-a strain) cells. White recombinant colonies were selected (n=102), revived on fresh plates and screened for expected insert by colony PCR. Clones showing the amplification of 1346 bp DNA fragment were considered as positive clones (n=73) carrying desired insert of 16S rRNA gene. Screened products of colony PCR were subjected to Restriction Fragment Length Polymorphism (RFLP) analysis by Haelll and clones with common banding pattern were removed (n= 12) and remaining colonies (n=61) were used for plasmid extraction. The concentration of the plasmid was determined and was subjected to automated DNA sequencing on ABI PRISM® 310 Genetic Analyzer (Apphed Biosystems, USA) using BigDye® Terminator v3.1 Cycle sequencing kit. Sequences with good quality value (n=60) were selected for further analysis. Sixty sequences of good integrity were subjected to in silico processing by three ways viz. Similarity search using MEGA BLAST at NCBI nucleotide database, Taxonomic classification by Ribosomal Database Project (RDP) and Phylogenetic analysis. Out of 60 clones, 46 clones (77%) showed similarities in the range of 95-99%, nine clones (15%) in range of 90-94% and five clones (8%) showed less than 90% (of which four clones falling between 85-89%) similarities with NCBI nucleotide database. Five clones (8%) showed similarities with known bacterial species (viz. Ruminococcus albus, Ruminococcus flavefaciens, Prevotella multiformis {2 clones} and Butyrivibrio fibrisolvens), five clones (8%) showed similarities with known bacterial genera (viz., Ruminococcus, Prevotella, sad Bacillus {3 clones}). Taxonomic classification by RDP revealed that 60 clones were mainly distributed into two phyla, namely Bacteroidetes with 21 (35.0%) clones, Firmicutes with 20 (33.0%) clones, 17 (29%) clones fell under unclassified bacteria and two (3%) clones were grouped under unclassified root. Phylogenetic analysis using neighbour-joining method revealed three clones (5%) out of 60 as spp, two clones (3%) as genera, one clone (1.6%) as family and 27 clones (45%) as imcultured/unidentified rumen bacteria. Remaining 27 clones (45%) appeared to be novel, which showed distinct genetic grouping than the other reported sequences in the database. All the sequences were submitted to GenBank and are available with the accession numbers FJ970656 to FJ970715 in EMBL, GenBank and DDBJ Nucleotide Sequence Databases.ThesisItem Open Access EFFECT OF DIFFERENT CATEGORIES OF SERA AND BOVINE SERUM ALBUMIN ON IN VITRO MATURATION OF SURTI BUFFALO OOCYTES(AAU, Anand, 2009) MISTRY, CHIRAG NATAVARLAL; Dhami, A. J.This study was conducted over a period of 6 months from September 2008 to February 2009 with the objectives of evaluating the effects of different concentrations (0.05, 0.1, 0.3, 0.6 and 0.9 per cent) of BSA-FAF and also of different categories of sera like Fetal Calf Serum (Gibco), Fetal Buffalo Serum, Oestrus Buffalo Serum, Postoestrus Buffalo Serum and Anestrus Buffalo Serum (all @ 20%) in relation to standard BSA (0.6%) on in vitro maturation of buffalo oocytes in TCM-199 medium. The rate of maturation was confirmed both by cytoplasmic and nuclear maturation using Hoechst stain 33342. A total of 456 ovaries of Surti buffaloes collected from the local slaughter house were transported to the laboratory at 30°C in normal saline solution within I72 hours of slaughter of animal for further processing. In all 1409 oocytes were recovered from them by using slicing method of surface follicles. The sera samples used for culture were obtained from the animals showing different stages of oestrous cycle and were heat inactivated in the laboratory. An average number of follicle of small, medium and large size found per ovary was 0.82, 0.48 and 0.24, respectively, with an overall mean of 1.55. The distribution of these follicles came to 53.18, 31.12-and 15.70 percent, respectively. The slicing method of oocyte recovery gave quite good result. The average oocyte recovery was 3.09 per ovary. The average recovery rate of Grade A, Grade B and Grade C oocyte was 1.02,1.22 and 0.85, respectively. The maturation rate with 0.05, 0.1, 0.3, 0.6 and 0.9 per cent concentration of BSA in TCM-199 was found to be 44.52, 50.99, 59.02, 84.43 and 64.29 per cent, respectively. The BSA 0.6 per cent yielded the highest maturation rate, which differed significantly from other BSA concentrations. The maturation rate for locally prepared FOBS, AnBS, FCS (Gibco), FBS and OBS was found to be 64.63, 54.55, 70.63, 60.48 and 78.16 per cent, respectively. The medium containing oestrus buffalo serum yielded significantly higher (P<0.05) maturation rate than the others, though it was little less than the BSA 0.6. The highest maturation of Grade A oocytes was found in BSA 0.6 followed by OBS and other sera. While in Grade B it was in BSA 0.9 followed by BSA 0.6, and for Grade C oocytes the highest maturation rate was with BSA 0.6 followed by FOBS. According to nuclear maturation, the highest number of oocytes with germinal vesicle was found in medium containing FBS (25.21 %) followed by AnBS and others. The highest number of germinal vesicle break down was found in FOBS (30.61 %) followed by FCS (Gibco) and others. The higher number of oocytes with Metaphase-I was in the medium containing BSA 0.6 per cent (22.13 %) followed by FCS (Gibco), while, the Metaphase-II stage was found to be higher in medium containing OBS (41.38 %) followed by BSA 0.6 and others. Degenerated oocytes were maximum with BSA 0.05 per cent (40.41 %) and minimum with OBS (9.20 %). It was concluded that BSA concentration of 0.6 per cent is the optimum for in vitro maturation of buffalo oocytes, and that OBS can be used instead of BSA as a cheaper and easily available source of serum for in vitro maturation of buffalo oocytes.ThesisItem Open Access TOLL LIKE RECEPTORS (TLR) EXPRESSION IN MILK SOMATIC CELLS DURING MASTITIS IN CATTLE USING REAL-TIME PCR(AAU, Anand, 2011) GHADIGAONKAR, DINESH DILIP; Rank, D. N.The dairy sector in India has shown remarkable progress in the recent years and consequently the country has now become the largest milk producer and valueadded milk products in the world. Though the country is the largest producer of milk, milk production per animal is much less compared to agriculturally developed countries. One of the reasons for this less milk production per animal is loss of milk production capacity because of inflammation of the mammary gland or mastitis in dairy animals. Mastitis is defined as an inflammatory reaction of the parenchyma of the mammary glands to bacterial, chemical, thermal or mechanical injury which is characterized by a range of physical, chemical and usually bacteriological changes in the milk and pathological changes in the glandular tissue which is the most common and the most expensive disease of dairy cattle throughout the world. Mastitis is classified as subclinical and clinical mastitis. The cows that have subclinical mastitis are reservoirs of organisms that lead to infection to other cows. Most clinical cases start as subclinical; thus, controlling subclinical mastitis is the best way to reduce the clinical cases. Somatic cells consist of leukocytes and epithelial cells exfoliated from the mammary epithelium. Mastitis is associated with an influx of inflammatory cells; hence somatic cell count of milk increases. Enumeration of somatic cell counts and bacterial culture of milk has been suggested as a standard method for detecting subclinical udder infections in dairy cows. Genes have major impact on health status of animals. Genetic variability of mastitis resistance is well established in dairy cattle. Resistance to mastitis is a complex function involving various biological pathways, molecules and cells. Study of the expression of genes involved in mastitis resistance is major tool for early diagnosis of disease and genetic improvement to superior stock. Toll Like Receptors (TLR) are cell-surface receptors that recognizes a broad class of pathogen-associated molecular patterns, activates immune system, and induces the over expression of inflammatory factors, which participate in irmate immune responses to confer disease resistance. The bovine TLR genes have been studied in recent years. Hence the study was planned with the objective to investigate expression of TLR-2, TLR-4, TLR-9 in somatic cells in healthy and mastitic udder by Real Time PCR in cattle. The study was undertaken to assess different TLRs (TLR-2, TLR-4 and TLR- 9) in three cattle breeds namely Gir, Kankrej and Triple crossbred (Kankrej x Jersey x Holstein Friesian) with sub-clinical mastitis. A total of 65 lactating cows comprising 16 Gir, 29 Kankrej and 20 Triple crossbred animals were screened for presence of mastitis using Electronic Somatic Cell Counter and bacteriological culture examination. Total RNA was extracted from milk somatic cells from 15 positive and 6 healthy quarters from each breed using TRIZOL method. The RNA was treated with DNase enzyme to remove any traces of genomic DNA. cDNA was synthesized from RNA using Qiagen's Omniscript reverse transcriptase kit and random hexamer primers. The amplification of cDNA template of TLR 2, TLR 4 and TLR 9 genes was carried out using gene specific primers. Expression of TLR 2, TLR 4 and TLR 9 genes mRNA was quantified by Real Time PCR and analysed using Applied Biosystems 7500 SDS software. Relative expression study of these genes was carried out using GAPDH as internal control. Results indicated that there was upregulation of TLR 2, TLR4 and TLR9 gene expression in animals affected with subclinical mastitis compared to healthy animals. Targeted amplification of 421 bp TLR 2, 108 bp TLR 4 and 108 bp TLR 9 was confirmed by agarose gel electrophoresis. Prevalence of subclinical IMI was higher in Triple crosbred cows (65%) compared to Gir (50%) and Kankrej cows (27.59 %). The mean SCC of infected quarters was significantly higher than that of noninfected quarters (P < 0.05) in all three breeds. The average relative expression of all three genes i.e. TLR2, TLR4 and TLR9 was higher (ranged from 7 to 35 folds) in mammary gland with subclinical intramammary infection than those measured in the uninfected glands. The concomitant increase in somatic cell count and upregulation of TLR2, TLR4 and TLR9 gene expression was observed during subclinical mastitis in all three breeds. Comparison of SCC upregulation between breeds indicated that, there was no significant difference between breeds in the SCC in the diseased quarter during subclnical mastitis in Gir, Kankrej and triple crossbred cows. In Gir cows, TLR2 gene expressions level in diseased quarters was found to be upregulated with an average 10.54 (10.54 ± 7.12) fold compared to pooled healthy quarters. In Kankrej cows, TLR 2 gene expressions level in diseased quarters was found to be upregulated with an average 12.22 (12.22 ± 11.61) folds compared to pooled healthy quarters. In Triple crossbred cows, TLR 2 gene expression level in diseased quarters was found to be upregulated with an average 7.13 (7.13 ± 10.57) folds compared to pooled healthy quarters. In Gir cows, TLR 4 gene expressions level in all diseased quarters was found to be upregulated with an average 18.43 (18.43 ± 24.230) fold upregulation compared to pooled healthy quarters. In Kankrej animals, TLR 4 gene expressions level in diseased quarters was found to be upregulated with an average 31.59 (31.59 ± 18.74) folds compared to pooled healthy quarters. In Triple crossbred cows, TLR 4 gene expression level in diseased quarters was found to be upregulated with an average 23.817 (23.817 ± 27.6963) fold compared to pooled healthy quarters. In Gir cows, TLR 9 gene expression level in diseased quarters was found to be upregulated with an average 6.193 (6.193 ± 8.19) fold compared to healthy quarters. In Kankrej cows, TLR 9 gene expression level in diseased quarters was found to be upregulated with an average 5.44 (5.44 ± 8.14) folds compared to Pooled healthy quarters. In Triple crossbred cows, in all diseased quarters, TLR 9 gene expression level was found to be upregulated with an average 19.29 (19.29 ± 16.31) fold compared to pooled healthy quarters. During subclinical mastitis SCC was found to be positively correlated with the transcriptional activities of TLR2, TLR4 and TLR9 gene in Gir and Triple crossbred cow. In Kankrej cows TLR 2 and TLR 9 gene expressions were positively correlated with s e c but TLR 4 gene expression was not correlated with SCC. The level of infection as reflected by number of somatic cells had significant effect on level of upregulation in gene expression. However, there was no significant effect of a breed on level of upregulation of TLR 2, TLR 4 and TLR 9 gene expression.ThesisItem Open Access Evaluation of Gender Pre-selection through Sperm Enrichment Techniques Using Real-Time PCR in Bovines(AAU, Anand, 2013) ROY, LATISH CHANDRA; Panchal, M. T.The present work was undertaken to assess the efficiency of the classical X and Y sperm enrichment methods, viz., sperm swim-up, gravity sedimentation, Sephadex filtration, and discontinuous Percoll density gradient centrifiigation, using the modem molecular technique of Real-Time PCR or qPCR in buffalo and cow bulls, in the Department of Animal Biotechnology and Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science & AH, Anand Agricultural University, Anand. Total of 12 semen ejaculates six each from buffalo and cow bull, diluted at the rate of 1:10 with Tris-fructose-yolk- glycerol (TFYG), were collected from the breeding bulls stationed at Semen Station, Amul Research and Development Association (ARDA), Ode, Anand and subjected to the different enrichment techniques. In sperm swim-up four time bound fractions were collected using a special swim-up tube. Similarly with gravity sedimentation, three fractions, with Sephadex filtration four fractions and with discontinuous Percoll density gradient centrifugation the bottom sperm pellet was collected. DNA was extracted from all the collected fractions and the control semen samples and was further used for Real-Time PCR. Four different neat semen dilutions were taken as standards for the Real-Time PCR, viz., 100.00, 75.00, 50.00 and 25.00 per cent, consisting of 50.00, 37.50, 25.00 and 12.50 per cent X-chromosome bearing sperms,' respectively, considering the theoretical ratio of 1:1 for X and Y sperms in an ejaculate. With gravity sedimentation, the X-chromosome bearing sperm percentage in the three collected fractions of semen samples, ranged from 19.96 to 43.99 (31.90±4.44), 41.10 to 46.93 (45.01±1.32) and 38.90 to 48.07 (43.67±1.40) per cent, respectively and 21.09 to 51.32 (35.22±4.00), 35.46 to 51.32 (43.26±2.19) and 34.86 to 42.31 (39.19±1.14), respectively, in buffalo and cow bulls with an overall mean Xchromosome bearing sperm percentage of 40.19±2.08 and 39.22±1.67 in buffalo and cow bull semen, respectively. In the four semen fractions obtained post-filtration through Sephadex (G-lOO) gel, X-chromosome bearing sperm percentage values ranged from 42.51 to 52.08 (46.08±1.42), 42.75 to 52.51 (47.69±1.68), 41.43 to 50.20 (45.96±1.22) and 42.36 to 49.17 per cent (44.80±0.98) as compared to control semen samples having the range of 46.76 to 50.20 per cent (48.48±0.4) in buffalo bull and 27.82 to 48.00 (41.99±3.00), 33.02 to 52.59 (43.75±2.67), 35.09 to 52.79 (43.48±2.35) and 33.32 to 50.15 (42.50±2.20) per cent, compared to the control with the range of 45.94 to 50.11 (47.67±0.76) in the cow bull semen samples. The overall mean was obtained to be 46.13±0.67 and 42.93±1.21 per cent, in buffalo and cow bulls, respectively. The X-chromosome bearing sperm percentage in the three swim-up fractions retrieved ranged from 42.00 to 59.57 (48.62±2.60), 42.16 to 50.61 (45.91±1.29) and 30.13 to 51.93 (44.09±3.15) per cent, respectively, and 33.60 to 45.84 (42.30±1.80), 34.61 to 47.28 (42.86±1.84) and 31.23 to 62.58 (44.07±4.17) per cent, respectively, with an overall values of 46.21± 1.41 and 43.08±1.54, in buffalo and cow bulls, respectively. For control buffalo and cow bull semen samples the X-chromosome bearing sperm values ranged from 46.76 to 50.20 (48.48±0.48) and 45.94 to 50.11 (47.67±0.76) per cent, respectively. With discontinuous Percoll gradient centrifugation, the X-chromosome bearing sperm percentage obtained in the bottom pellet ranged from 43.79 to 51.83 (48.93±1.93) percent against the control value of 45.07 per cent in buffalo bulls and 48.20 to 56.89 (52.42±1.23) per cent, compared to the 50.56 per cent of the control, in cow bull semen samples. No detrimental effect was observed on individual motility of the sperms following any of the sperm enrichment procedures. None of the four methods evaluated proved efficient enough in altering the sex ratio of the sperms. No significant differences in X-chromosome bearing sperms were observed in any of the methods as compared to control, except in gravity sedimentation, where, a highly significant difference was found between the different fractions, both in buffalo and cow bulls.ThesisItem Open Access DETECTION OF POLYMORPHISM IN BOVINE PREIMPLANTATION ACTIVE GENES AND THEIR ASSOCIATION WITH SEMEN QUALITY(AAU, Anand, 2008) AHIR, VIRAL B.; Panchal, M. T.Embryo development in mammals is marked by distinctive biological processes that occur during the preimplantation and early post implantation periods. Preimplantation development encompasses the period from fertilization to implantation, which occurs in different times in various species and it is marked by a number of critical events. This development is a mammalian-specific event, and is vital for successful implantation and pregnancy. Bovine preimplantation embryo development is under constant control of genes activated from either maternal or embryonic genome. Large-scale association studies by genotyping many single nucleotide polymorphisms (SNPs), in individuals with well characterized phenotypes, are considered as promising methods to identify the cause of many complex traits. The present study was undertaken to study the polymorphism of bovine preimplantation active genes loci by PCR-RFLP and PCR-SSCP techniques and their association with various semen quality traits in Murrah buffalo bulls belonging to ARDA, Ode during January to June 2008. The mean and standard error of mean (SEM) for various semen quality parameters, viz., volume (ml), concentration (106/ml), motility (%), motility after thawing(%) and live and dead count (%) was found to be 3.35+0.27, 1511.07+112.25, 73.54+1.05, 54.39+0.66 and 85.44+0.47, respectively. Semen DNA was extracted from 41 Murrah buffalo bulls by Proteinase K method as per standard protocol. Bovine COX-2, CD9, DSC2, AKRIBI and CDHl genes specific primers (COX-2 F: 5'-TGA TCT ACC CGC CTC ATG TT-3' and COX-2 R: 5'-CCC TTT GCC TGG TGA ATG-3'); (CD9 F: 5'-GAG GCA AAA CTC CAA AAC CA-3' and CD9 R: 5'-CTC CAC TGT CGT TTG TCG TG -3'); (DSC2 F: 5'-AAA GTG CAA GAC ATG GAT GG-3' and DSC2 R: 5'-CCT TCA TTG GTT TGG GAA TC-3'); (AKRIBI F: 5'-ACC AGG GCT TAC CTG GAA GT-3' and AKRIBI R: 5'-GGT CAA TGG GCC TTA GGA TT-3') and (CDHl F: 5'-CGC ACA ACA AAA TGT TCA CC-3' and CDHl R: 5'-GGC CTC AAA TCT CCA GAC AA-3') were used to amplify bovine preimplantation active genes loci. PCR was carried out in 25 µl volume for 35 cycles of denaturation at 94°C, annealing at appropriate temperature (COX-2 locus at 52°C, DSC2 and CDHl loci at 51°C, AKRIBI locus at 58°C) and extension at 72°C. Initial denaturation was carried out at 94°C for 5 minutes, while the final extension was performed at 72°C for 5 minutes. For the CD9 locus "Touch down PCR" was performed to avoid spurious priming during PCR amplification. Amplified products were electrophoresed on 2% Agarose gel at 80 V for for 60 minute. For RFLP analysis Amplified PCR product of COX-2, CD9, DSC2 and AKRIBI loci were digested with Alu I, Dra I, Rsa I and Nde /restriction enzymes respectively, by incubating them at 3 7°C for 14-16 hours except for Rsa I which was incubated at 37°C for 12 minute and electrophoresed on 2% Agarose gel at 80 V for 60-90 minutes to reveal the restriction pattern. Monomorphic pattern was observed for the COX-2, CD9 and DSC2 loci and only TT, TT and AA genotypes, respectively, were found in all Murrah buffalo bulls at these loci. The allelic frequencies of T, T and A alleles were 1.00, with absence of A, A, and G alleles, respectively. For AKRIBI locus, 18 samples were found to be homozygous AA and 23 samples were heterozygous AG, with allelic frequency of 0.725 and 0.275 for A and G alleles, respectively. For SSCP analysis, PCR products of CDHl locus were denatured and electrophoresed on 6% non-denaturing PAGE for 4-5 hours at constant 5W. Analysis revealed four different banding patterns with frequencies for pattern 1, pattern 2, pattern 3 and pattern 4 to be 0.463, 0.146, 0.292 and 0.097, respectively. Since, loci COX-2, CD9 and DSC2 were found to be monomorphic, h was not possible to correlate them with the semen quality traits. Loci AKRIBI and CDHl were found to be polymorphic but, statistical analysis revealed no significant association (P>0.05) of this loci with any semen quality parameters.ThesisItem Open Access ISOLATION OF PPR VIRUS, DETECTION BY ELISA AND DIFFERENT GENE BASED RT-PCR(AAU, Anand, 2008) CHOUDHARY, POOJA; Jhala, M. K.Peste des petits ruminants (PPR) is a severe viral disease of goats and sheep with high morbidity and sometimes high mortality characterized by fever, erosive stomatitis, conjunctivitis, gastroenteritis and pneumonia. PPR is caused by Peste des petits ruminants virus (PPRY), a Paramyxovirus of the Morbillivirus genus. The disease causes severe economic losses to small ruminant husbandry and is presently considered as one of the major threats to about 200 million small ruminant population of the country. The present study was aimed to detect PPRV in clinical samples using s-ELISA and to derive estimates of overall, locationwise and specieswise incidence of PPRV. The study also involved the isolation of PPR virus from clinical samples and assessment of F, N and H gene targets for detection of PPRV by RT-PCR from the clinical and cell culture samples. A total of 98 clinical samples comprising of 48 tissues, 12 blood and 38 serum samples from 79 animals including 26 sheep and 53 goats suspected of PPRV infection, were collected from three different districts of Gujarat (Rajkot, Bhavnagar and Gandhinagar) and tested for PPRV antigen by s-ELISA (PPR s-ELISA kit, developed by Division of Virology, IVRI, Mukteshwar), of which 75 animals were found positive yielding an overall incidence rate of 94.90 per cent. Out of 10 animals (goat) suspected of PPR, six were positive (60%) by s-ELISA in Rajkot district. All the 32 and 37 animals (sheep and goats) showing clinical signs suggestive of PPR from Bhavnagar and Gandhinagar districts were found positive by s-ELISA yielding 100 %'incidence at both these locations. Sheep was found to be more susceptible to infection yielding a positivity rate of 100 per cent than goats (92.4%). The PPR antigen could be detected marginally more in tissue samples (95.83%) than in blood (83.33%) and serum samples (89.47%) by s-ELISA. A total of 23 samples including 15 cell culture samples, six tissue samples, one whole blood and reference vaccine virus (Sungri isolate) were processed for RNA extraction using TRI Reagent®. RNA samples showing acceptable purity and concentration were reverse transcribed with random hexamers to generate cDNA templates, which were subjected to PCR amplification using F, N and H gene based primers. Reference vaccine virus as well as 10, 11 and 8 out of 15 cell culture samples of the three isolates produced approximately 372 bp amplicon with F1 / F2, 351 bp amplicon with NP3 / NP4 and 713 bp amplicon with H1 / H2 primers respectively. A total of 23 samples were tested by both s-ELISA and RT-PCR, including reference vaccine virus, seven field samples (six tissues, one whole blood) and 15 cell culture samples. Out of the total samples tested, PPRV could be detected in reference vaccine virus and 19 samples by s-ELISA and 15, 18 and 11 samples including reference vaccine virus by F, N and H gene based RT-PCR respectively. None of the sample positive in RT-PCR was negative by s-ELISA. Relative to s-ELISA, sensitivity of the RT-PCR for F, N and H gene was 78.94, 94.70 and 57.89 respectively and specificity for all the three was 100 per cent. Three representative samples comprising of one pooled tissue sample, one whole blood sample and one serum sample were inoculated in Vero cells for five viral passages to isolate the field PPR virus. All the three samples inoculated showed similar CPE. During first passage, changes associated with rounding of cells and isolated initiation foci were observed. During second and third passages, CPE characterized by ballooning of cells and later aggregation of cells followed by formation of fusion mass and syncytia were recorded. Cell lysis was also observed in few cases. During fourth and fifth passages, the above mentioned CPE increased in intensity with more number of cells showing fusion mass and detachment. The monolayer infected with sterile PBS (negative control) did not show such changes. The isolation of PPRV in cell culture was confirmed by s-ELISA after second passage for all the three samples and after P3, P2 and P2 passage by F, N and H gene based RT-PCR.ThesisItem Open Access METHYLATION DETECTION IN H19 GENE IN BUFFALO [Bubalus bubalis) BY BISULFITE SEQUENCING(AAU, Anand, 2011) PATEL, HIREN MAVJIBHAI; Joshi, Chaitanya G.It is increasingly clear that translation of the genetic code into proteins is not the only way that our genes influence our growth, development and health. Another system of influence on the expression of genes is referred to as epigenetics. Any biochemical modification of the DNA or chromatin that can account for epigenetics gene expression system, only one candidate mechanism that is site-specific DNA methylation, has received experimental support to date. Methylation of DNA in mammalian cells occurs at cytosine residues in CpG dinucleotides. Improper or absence of DNA methylation of imprinted gene may lead to abnormal growth or cancerous condition. The best candidate for the epigenetic mark at the H19/Igf-2/Ins-2 locus is paternal-specific DNA methylation of the H19 and its 5' flank. Methylation status of H19 influences the expression of IGF-2. Keeping in consideration that methylation status ofH]9 influences the IGF2 expression, present study was carried out to detect methylation status in H19 promoter in Jaffarabadi, Surti and Mehsani buffalo by bisulfite sequencing. DNA extraction from blood was carried out by phenolxhloroform method from seven sample of each breed which were subjected to bisulfite treatment by sodium bisulfite. Quality and quantity of DNA was checked by ND-1000 spectrophotometer and 0.8% agarose gel electrophoresis. Locus specific primers for normal DNA and for bisulfite treated DNA were used to amplify a gene fragment of H19 in three breeds of Bubalus bubalis. Purification of PCR product was carried out by eluting desired PCR product from agarose gel by using by QIAquick® Gel Extraction Kit and later the PCR products were ligated in pTZ57R/T vector of InsT/Aclone TM kit (Fermentas). Ligated recombinant vector was transformed in competent E. coli (DH5-α) cells. Recombinant colonies were identified by blue-white screening and white conies were subjected to Ml3 colony PCR for confirmation of positive recombinant clones. White colony containing recombinant clone was grown in LB broth and recombinant plasmids were isolated using QIAprep® Spin Miniprep Kit and used for cycle sequencing, that were later processed for sequencing. Multiple sequence alignment was done for all 21 samples using BioEdit v 7.0.7.1, which revealed no difference between all samples. Four clones from each bisulfite treated samples were sequenced and subjected to methylation study by BiQ Analyzer and BISMA softwares. In H19, 20 CpGs were revealed in all three breeds and were subjected to methylation study. In all three breeds, highest methylation per cent was found to be 94.12, while in some sample it showed no methylation at any CpGs site. The overall methylation per cent of HI9 gene in Jaffarabadi, Surti and Mehsani buffaloes were observed to be 50.19, 70.85 and 52.24, respectively. The incidence of mean per cent methylation in H19 gene in all three breeds was found to be 57.36. Unexpected nucleotide conversion (T>C, A>G and G>A) and deletion (A and G) after bisulfite sequencing were observed. Methylation of non CpG cytosine was observed which were found at CpA and, only in one animal at CpT. In some case, three CpG out of twenty were not analyzed due to non specific conversion of CG>TA. For estimation of association of milk production traits with methylation pattern, animals were grouped into high and low group with respect to milk yield and milk fat percentage. Statistical analysis indicated that there was no significant difference in high and low group with respect to milk yield and milk fat per cent among methylation pattern in all three breeds. Screenings of more number of animals are needed to get reliable data for estimation of association of milk production traits with methylation pattern.
