Skip navigation
Beta Version
South African Society for Animal Science

Data of 698 Murrah cows sired by 43 bulls maintained at the Central Cattle Breeding Farm, Alamadhi were analysed to study the performance of Murrah buffaloes at the coastal region of Tamil Nadu, India. Least-squares means and genetic parameters were estimated for different first lactation traits. The averages for 305-day and total lactation milk yields were 1616.3 ...


A total of 297 sheep were genotyped for polymorphism in the IGF-I gene in Mecheri and Madras Red sheep breeds. In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed th...


Karyological studies and sister chromatid exchange analysis were carried out in Toda buffaloes stationed at the Sheep Breeding Research Station, Sandynallah, Ooty, Tamil Nadu. Mitosis was induced by pokeweed mitogen in short term leucocyte cultures and bromodeoxyuridine was incorporated in the cultures to elucidate the sister chromatid exchanges. The modal c...


A study was undertaken in 203 Murrah and graded Murrah buffaloes reared under organised farm and farmers field conditions in Tamil Nadu and Andhra Pradesh to study the polymorphism of FSHR gene by PCR- RFLP method and to analyse the possible associations of these gene variants with age at first calving and calving intervals. The PCR amplification carried out with s...


The study was conducted to ascertain the effect of supplemental tryptophan on uterine histomorphological structures of white Leghorn layers. A total of 350 White Leghorn layers of 18 weeks were allocated to seven experimental groups, each of which included 5 replicates and reared upto 45 weeks of age. Experimental diets consisted of two protein diets along with...


Epitheliogenesis imperfecta, a congenital abnormality involving the skin has been reported in several domestic and wild animal species. In cattle, affected calves die shortly after birth due to septicaemia. A case of this disease in a graded Friesian calf, in which the animal has survived, is reported. Histopathology and type of lesions confirmed the disease. Kar...


Estrogen hormone is an important hormone found to be linked with reproductive traits and affect the growth, differentiation and function of reproductive tissues. Estrogen receptor gene (ERα) is considered as candidate marker for fertility traits in farm animals. The present study was undertaken with 203 buffaloes from different locations. The Polymerase Chain ...


Karyological studies on chromosomes of the Indian muntjac (Muntiacus muntjak) commonly referred to as barking deer were carried out. The diploid (2n) chromosome number in Muntiacus muntjak was 7 in males and 6 in females. There were one pair of metacentric chromosomes and one pair of acrocentric chromosomes. The X chromosome was submetacentric. The two Y ...


The Indian Giant squirrel syn. Malabar giant squirrel (Ratufa indica) is an uppercanopy dwelling mammal, endemic to southwestern, central and eastern peninsular India, found specifically in the Western Ghats, Satpuras and Eastern Ghats. It is seen at elevations of 180– 2300 m and is widely distributed1. The species has been classified under the Class, Mamm...


The data pertaining to variable production and reproduction traits of Murrah bulffaloes (1980 lactation records of (398 Mun'ah buffaloes) were collected from the Central Cattle Breeding Farm, Alamadi. Tamil Nadu, India.

Indian Veterinary Association

The aim of this research was to test the CHD (Chromo Helicase DNA-binding gene) gene as molecular marker for sexing dimorphic and monomorphic birds because of its high degree of conservation and different lengths in Z and W chromosomes due to different intron sizes. Sex determination was attempted in 74 samples of 10 ratite and one non ratite species. Genomic DNA w...

Indian Veterinary Association

The aim of this research was to test the CHD (Chromo Helicase DNA-binding gene) gene as molecular marker for sexing dimorphic and monomorphic birds because of its high degree of conservation and different lengths in Z and W chromosomes due to different intron sizes. Sex determination was attempted in 74 samples of 10 ratite and one non ratite species. Genomi...


Pesti des Petitis Ruminants is a highly contagious disease of goats caused by virus belonging to moribilivirus genus of family “Paramyxoviridae”. Pesti des Petitis Ruminants is an acute or sub acute viral disease of goats and sheep and literarily means “disastrous diseases of small ruminants” in French. Usually goats are more severely affected than sheep. In Ind...


The present study was undertaken with 204 buffaloes during June, 2016 to July, 2017 from different locations viz., Saraswathi Krishi Vigyan Kendra, Karur district, Tamil Nadu; Post Graduate Research Institute in Animal Sciences (TANUVAS), Katupakkam, Tamil Nadu; Central Cattle Breeding Farm, Alamadhi, Chennai, Tamil Nadu; Buffalo Research Station, Venkataramanna Gu...


Polymorphic variants of keratin-associated protein (KAP) 6.1 gene with wool traits of Sandyno and Nilagiri breeds of sheep were investigated in this study. Genomic DNA was isolated from blood samples of 125 Sandyno, Nilagiri and Dorset x Nilagiri breeds of sheep along with 76 numbers of wool samples. A 528 bp segment was amplified by PCR using ovine specific pri...


Background: Premature Centromere Division (PCD) was observed in the chromosomes of metaphase spreads in a patient with the history of recurrent abortions. Case Report: Short term leukocyte cultures were set up with blood sample from the woman with a history of recurrent abortions for the past four consequent years. 25 % of the metaphase spreads screened displayed p...

Tamil Nadu Veterinary and Animal Sciences University
Agricultural Research Communication Centre

Data on ages at first mating and first calving of Murrah buffaloes to identify the effect of various non-genetic factors on these traits. Period and season were the fixed environmental effects considered for both the traits studied. The overall least-squares means for ages at first mating and calving were 1222.3 ± 11.0 and 1578.7 ± 20.3 days respectively. Period h...